ID: 1049790191

View in Genome Browser
Species Human (GRCh38)
Location 8:144468857-144468879
Sequence ATAGGCTGCCCAGAGAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 281}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049790191_1049790199 -2 Left 1049790191 8:144468857-144468879 CCCCTCCTCTCTGGGCAGCCTAT 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1049790199 8:144468878-144468900 ATTCACTGTTCTTTTGACGGGGG 0: 1
1: 0
2: 1
3: 7
4: 111
1049790191_1049790201 8 Left 1049790191 8:144468857-144468879 CCCCTCCTCTCTGGGCAGCCTAT 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1049790201 8:144468888-144468910 CTTTTGACGGGGGCGTTCCTGGG 0: 1
1: 0
2: 0
3: 4
4: 36
1049790191_1049790202 9 Left 1049790191 8:144468857-144468879 CCCCTCCTCTCTGGGCAGCCTAT 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1049790202 8:144468889-144468911 TTTTGACGGGGGCGTTCCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 43
1049790191_1049790197 -4 Left 1049790191 8:144468857-144468879 CCCCTCCTCTCTGGGCAGCCTAT 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1049790197 8:144468876-144468898 CTATTCACTGTTCTTTTGACGGG 0: 1
1: 0
2: 0
3: 23
4: 196
1049790191_1049790200 7 Left 1049790191 8:144468857-144468879 CCCCTCCTCTCTGGGCAGCCTAT 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1049790200 8:144468887-144468909 TCTTTTGACGGGGGCGTTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 37
1049790191_1049790203 15 Left 1049790191 8:144468857-144468879 CCCCTCCTCTCTGGGCAGCCTAT 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1049790203 8:144468895-144468917 CGGGGGCGTTCCTGGGGAGTTGG 0: 1
1: 0
2: 1
3: 8
4: 142
1049790191_1049790196 -5 Left 1049790191 8:144468857-144468879 CCCCTCCTCTCTGGGCAGCCTAT 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1049790196 8:144468875-144468897 CCTATTCACTGTTCTTTTGACGG 0: 1
1: 0
2: 2
3: 17
4: 256
1049790191_1049790198 -3 Left 1049790191 8:144468857-144468879 CCCCTCCTCTCTGGGCAGCCTAT 0: 1
1: 0
2: 0
3: 22
4: 281
Right 1049790198 8:144468877-144468899 TATTCACTGTTCTTTTGACGGGG 0: 1
1: 0
2: 0
3: 9
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049790191 Original CRISPR ATAGGCTGCCCAGAGAGGAG GGG (reversed) Intronic
900081993 1:865365-865387 ACAGGGTGGGCAGAGAGGAGAGG - Intergenic
900544488 1:3220851-3220873 ATAAGCTGCCCAGGGAGGAAAGG + Intronic
901260784 1:7869148-7869170 AGAGGCTGCCCAAGGTGGAGAGG + Intergenic
902160693 1:14528074-14528096 AGAGGCTGCATAGAGTGGAGAGG - Intergenic
902466796 1:16623682-16623704 ATCTGCAGCCCAGAGAGGAAAGG + Intergenic
902507812 1:16949092-16949114 ATCTGCAGCCCAGAGAGGAAAGG - Intronic
903854438 1:26328466-26328488 ATAGGGTTCCCAGGGCGGAGAGG + Intronic
905456461 1:38091554-38091576 AGAAGCTGCACAGTGAGGAGAGG + Intergenic
906140977 1:43533273-43533295 CAAGGCTGCCAAGAGAGGAGGGG + Intronic
906159293 1:43635857-43635879 ATATGTTGCCCAGGGTGGAGTGG - Intergenic
906274569 1:44506478-44506500 AAAGGCTGCCCCGAGTGGAGAGG - Intronic
906702805 1:47872149-47872171 ATAGGGTCCCCAGAGAGGATGGG - Intronic
907403642 1:54240780-54240802 ATGTGCTGCCCAGGAAGGAGTGG + Intronic
907451045 1:54546086-54546108 ATAGAAAGCGCAGAGAGGAGAGG + Intronic
907491042 1:54808954-54808976 AGAGGCTGCCAAGGGAGGAAGGG - Intronic
907522115 1:55030705-55030727 CTGGGGAGCCCAGAGAGGAGTGG - Intergenic
908548915 1:65189603-65189625 ATAAGTTCCCCAGAGAGCAGAGG + Intronic
909757080 1:79240010-79240032 CCAGGCTGCACAGAGAAGAGTGG + Intergenic
913523236 1:119666075-119666097 ATATACTGGCCAGAGAGAAGAGG + Intronic
915604394 1:156941557-156941579 CTTGGCAACCCAGAGAGGAGGGG + Intronic
918540798 1:185630509-185630531 ATAGGCTGGCCTGAAAGCAGTGG - Intergenic
919151799 1:193710618-193710640 AAAGGCTGCCCAGGGATCAGTGG - Intergenic
920257910 1:204668678-204668700 AACTGCAGCCCAGAGAGGAGTGG - Intronic
920506259 1:206517545-206517567 CCAGGCTGCCCAGAGATGACAGG - Intronic
922179906 1:223225442-223225464 AAAGACTGCCCAGAGAGGGCGGG + Intronic
922501228 1:226098435-226098457 AAAGGATGCCCAGAAAGGTGTGG + Intergenic
922527741 1:226318679-226318701 CTTGGCTGCCCAGGGAGTAGTGG - Intergenic
922537071 1:226389230-226389252 AGAGGCTGCTCACAGAGGTGGGG + Intronic
923035007 1:230279655-230279677 CTGGGCTGCACCGAGAGGAGGGG - Exonic
923436341 1:233971213-233971235 ACTGGCTGCCCAGAAGGGAGAGG + Intronic
924627835 1:245710456-245710478 ATATCCTTCCCAGAGACGAGAGG - Intergenic
1063034350 10:2270626-2270648 TTAGGCTCTTCAGAGAGGAGGGG + Intergenic
1064742437 10:18447584-18447606 AAATGCTGCAGAGAGAGGAGTGG + Intronic
1067714040 10:48672715-48672737 ACAGACAGCCCAGAGAGGAGAGG + Intergenic
1068838960 10:61589025-61589047 TTAGGCTGCCCAAAGAAGACAGG - Intergenic
1069593174 10:69654482-69654504 CTTGGTGGCCCAGAGAGGAGGGG + Intergenic
1069716329 10:70523557-70523579 ATAGGCAGCTCAAAGAGGGGAGG - Intronic
1070630727 10:78082599-78082621 GAAGGCTGGACAGAGAGGAGAGG - Intergenic
1070778320 10:79123131-79123153 AAAGGCTGGCCACAGATGAGAGG + Intronic
1071671267 10:87611552-87611574 CTAGGCTGCACACAGCGGAGGGG - Intergenic
1071770760 10:88726891-88726913 AGAGGATGCCCAGGGAGGACAGG + Exonic
1074279756 10:112039733-112039755 AGAAGCTGGCCAGAGATGAGAGG + Intergenic
1074750847 10:116585750-116585772 AGAGGCTGCAGAGAGATGAGAGG - Intergenic
1075253628 10:120906323-120906345 AGAGGAGGCCCAGAGAGCAGGGG + Intronic
1075585601 10:123655873-123655895 AGGGGCTGCCAAGAGAGGAAAGG + Intergenic
1076322027 10:129589996-129590018 AGAGGCTGCTCAGACAGGATGGG + Intronic
1076540900 10:131214166-131214188 AGAGCCTGCCCAGGGAGGGGTGG + Intronic
1077183940 11:1228249-1228271 CCGGGCTGCCCAGAGAGGCGGGG + Intronic
1077868362 11:6241133-6241155 AGAGGGTCCCCAGAGAGGAGGGG + Intronic
1078251506 11:9620329-9620351 ATAGACTAGCTAGAGAGGAGAGG - Intergenic
1079346522 11:19657267-19657289 ACTGGATGCCCAGAAAGGAGTGG - Intronic
1079470798 11:20775646-20775668 AGAGGCAGCCTAAAGAGGAGTGG + Intronic
1080041764 11:27766738-27766760 AAAGGCAGCCCAGAGTGTAGTGG - Intergenic
1080065080 11:28002098-28002120 CTAGGCTGCACAGAGCAGAGGGG - Intergenic
1081792664 11:45799349-45799371 TTAGGCAGCCCAGAGCTGAGAGG + Intergenic
1081811479 11:45916626-45916648 ACAGGCTGCCAAGAGAGAAAGGG - Intronic
1082002882 11:47403417-47403439 AGAGGCTGGACAGAGAGTAGTGG + Intergenic
1083290980 11:61689988-61690010 AGAGGCTGCCCAGACCAGAGAGG - Intronic
1084029601 11:66473624-66473646 AGAGGCGGCCCAGAGAGGACTGG - Intronic
1084498404 11:69519362-69519384 GAAGGCTGCCTAGAGAGCAGGGG - Intergenic
1084933329 11:72574074-72574096 TGAGGATGCCCAGGGAGGAGAGG - Intergenic
1089248518 11:117139593-117139615 AGAGGCAGCCCAGCCAGGAGCGG - Intergenic
1090646267 11:128768847-128768869 ACGGGCTGCTCAGAGAGCAGAGG + Intronic
1091142961 11:133251822-133251844 CTTGGTTGCCCAGAGAGGAAGGG + Intronic
1091584034 12:1805811-1805833 GCAGGCTGCCCAGAGTGGAAAGG + Intronic
1092096228 12:5844249-5844271 CTAGGCTACACAGAGAGGTGTGG + Intronic
1093316477 12:17657377-17657399 ATTTGCTGGCCAAAGAGGAGTGG + Intergenic
1095292638 12:40493096-40493118 ACAGGATGCCCTGAGAGTAGTGG - Intronic
1096003576 12:48149852-48149874 AAAGGCTGCCCAGTGAAGTGGGG + Exonic
1096408904 12:51363279-51363301 ACAGGCTGCCTGGAGAGGGGAGG + Intronic
1096500076 12:52059298-52059320 AAAGGCTGCCCAGGAAGGCGGGG - Exonic
1096661631 12:53128922-53128944 AAAGGGTGTCCAAAGAGGAGGGG - Intergenic
1097900027 12:64863317-64863339 AAAGGAAGCCCAGAGAGGTGGGG + Intronic
1101529178 12:105558730-105558752 TAAGACTTCCCAGAGAGGAGGGG - Intergenic
1101651722 12:106683219-106683241 ATGTGCTGCCCAGGGATGAGAGG - Intronic
1102043981 12:109818198-109818220 ATAGATTGACCAGGGAGGAGAGG + Intronic
1103288779 12:119826508-119826530 CTAGGCTGCCTAGACAGGGGTGG - Intronic
1104393243 12:128408950-128408972 ACAGGCTGCACTGAGAGGAAGGG + Intronic
1104901473 12:132191702-132191724 CAAAGCTGCCCAGTGAGGAGAGG + Intergenic
1107672952 13:42765362-42765384 ATATGAAGCCCAGAGAAGAGTGG - Intergenic
1107977610 13:45704909-45704931 ATAAGAAGCCCAGAGATGAGTGG - Intronic
1108956700 13:56166998-56167020 TTAGGCTGCACAGAGTGGTGGGG + Intergenic
1109513045 13:63404438-63404460 CTAGGCTGCACAGAGCAGAGGGG + Intergenic
1112130436 13:96517437-96517459 ATAGGCTTCCCAGGGAGATGGGG + Intronic
1112317087 13:98372460-98372482 ACGGGATGCCCAGAGAGAAGGGG - Intronic
1112319778 13:98395651-98395673 ATCTGCTGTCCAGGGAGGAGGGG + Intronic
1113497570 13:110743865-110743887 CTAGGCTGCACAGAGCAGAGGGG + Intergenic
1116784088 14:49268702-49268724 CTAGGCTGCACACAGTGGAGGGG - Intergenic
1116807476 14:49507989-49508011 ACAGGCAGCCCAGTGTGGAGGGG + Intergenic
1117728244 14:58695398-58695420 ATTGGCTGCCCACAGATGTGTGG + Intergenic
1118809452 14:69262206-69262228 AGAGGCTGGGCAGGGAGGAGAGG + Intronic
1119327813 14:73771959-73771981 AGAGGCAGCCCAGAGGTGAGTGG + Intronic
1120799812 14:88675492-88675514 CTAGGCTGCACAGAGTAGAGGGG + Intronic
1121562293 14:94884577-94884599 CTTGGAGGCCCAGAGAGGAGGGG - Intergenic
1121913034 14:97809455-97809477 AAAGGCTTCCCAGAGAGGTGTGG - Intergenic
1126261367 15:46696640-46696662 ATAGAGTGACCAGAGAGAAGAGG - Intergenic
1126357904 15:47815592-47815614 ACAGGCTGCCAAAAGAGGGGAGG + Intergenic
1126747223 15:51838209-51838231 ATTAGCTACACAGAGAGGAGTGG - Intronic
1126859581 15:52870981-52871003 ATAGCCAGCCCTGAGAAGAGGGG - Intergenic
1128332376 15:66763931-66763953 AGTGGCTGCCCAGGAAGGAGTGG - Intronic
1128358274 15:66943456-66943478 TTAGGATGGTCAGAGAGGAGAGG + Intergenic
1129705761 15:77793191-77793213 CAAGGCTCCCCAGAGAGCAGAGG + Intronic
1132843031 16:1987455-1987477 AGAGGCTGCCCAGAGGGGCCAGG + Exonic
1132973433 16:2700138-2700160 AGAGGCAGGCCAGGGAGGAGGGG - Intronic
1135737350 16:24942917-24942939 ATAGGTTGCCCAGTGAGGATGGG - Intronic
1135959901 16:26986854-26986876 ACAGGCTGGCCAGGGAGGTGGGG - Intergenic
1136359149 16:29766635-29766657 ATGGGGTGCCCATAGAGAAGGGG + Intergenic
1138125965 16:54438669-54438691 GAAGGTTGCCCAGAGAGGAAAGG - Intergenic
1139216075 16:65124520-65124542 AAATGCTGAACAGAGAGGAGAGG - Intronic
1139349981 16:66328797-66328819 ATAGGCAGGTCAGGGAGGAGGGG + Intergenic
1141088065 16:81110755-81110777 ATAGGATGATCAGGGAGGAGAGG + Intergenic
1141982038 16:87556812-87556834 TTTTGCTGACCAGAGAGGAGCGG - Intergenic
1143378156 17:6479416-6479438 CTGAGCTGCCCAGAGAGGAGGGG - Intronic
1143550925 17:7630063-7630085 AAAGGTTGCCCGGGGAGGAGGGG - Intronic
1144374384 17:14625186-14625208 ACACGATACCCAGAGAGGAGGGG + Intergenic
1144831771 17:18135891-18135913 AGAGGCTGCCCACAAAGGATCGG - Intronic
1145950390 17:28812505-28812527 ATTGGCTGTGCAGACAGGAGAGG - Intronic
1147238071 17:39072159-39072181 ATTCACTGCCCAGAAAGGAGTGG - Intronic
1147421752 17:40325380-40325402 GTAGGCTTGCCAGGGAGGAGAGG + Intronic
1148195717 17:45711156-45711178 TCAAGCTGCCCAGTGAGGAGGGG - Intergenic
1148971742 17:51489789-51489811 GTAGGCCTCCCAGAGAGGAAAGG - Intergenic
1149003282 17:51778813-51778835 TCAGGCTGCTCAGGGAGGAGAGG + Intronic
1151556436 17:74849218-74849240 TGAGGCTGGCCAGACAGGAGTGG - Intronic
1151570400 17:74922951-74922973 GTAGGCAGCCCAGAGAGTGGGGG + Exonic
1152146250 17:78570475-78570497 AGAGGGTTCCCAAAGAGGAGGGG + Intronic
1153382684 18:4455694-4455716 AACGGCTGGCAAGAGAGGAGGGG - Intergenic
1153980337 18:10303310-10303332 CTAGGCTGGCCATAGGGGAGAGG - Intergenic
1157130339 18:45001494-45001516 GTAGGCTGCCCGAAGAGGTGGGG + Intronic
1159810049 18:73007508-73007530 AGATGCTGCCCAGTGAGGAGAGG - Intergenic
1160131691 18:76231065-76231087 ACAGGCTGCCCAGTGACCAGTGG + Intergenic
1162127448 19:8507047-8507069 AGAGGCTGCAGGGAGAGGAGGGG - Intergenic
1162371614 19:10283507-10283529 ACTGGCTGCCAAGAGGGGAGGGG - Exonic
1165094810 19:33404300-33404322 ATAGCCTGGGCAGAGAGGACAGG + Intronic
1166432798 19:42741237-42741259 ATAAGCTGGGCAGAGAAGAGAGG - Intronic
1166538682 19:43592019-43592041 TGAGCCTGCCCAGTGAGGAGTGG - Exonic
1166557448 19:43710303-43710325 TGAAGCTGCCCAGAGAGGTGTGG - Intergenic
1167061930 19:47154442-47154464 ATAAGCTGCCCACAGCAGAGGGG + Intronic
926234050 2:11026182-11026204 GGAAGCTGCCCAGGGAGGAGGGG + Intergenic
927705228 2:25292670-25292692 CAAGGCTGCCAAGAGAGGACAGG - Intronic
928102972 2:28450123-28450145 ATGTGCTGCCCCCAGAGGAGGGG - Intergenic
929778304 2:44942084-44942106 ATGGACTGACCTGAGAGGAGAGG - Exonic
931283910 2:60816960-60816982 AAAGGCTTCCCTGAGAGGTGTGG - Intergenic
931949868 2:67350288-67350310 CTAGGCTGCACACAGAAGAGGGG + Intergenic
932234216 2:70108309-70108331 AGAGGGGGCCCAGAGAGCAGTGG + Intergenic
932576953 2:72967783-72967805 AAAGGCTGCGCAGAGAGGGCGGG - Intronic
934067259 2:88351277-88351299 AAAGGCAGCCCAGAGACGATAGG + Intergenic
934475649 2:94591673-94591695 ATGGGCTGGCCACGGAGGAGTGG - Intronic
934511218 2:94946232-94946254 AAAGGGTGGCCAGAGAGAAGGGG - Intergenic
935218531 2:100992860-100992882 AAAGGCAGCCCACAGAGTAGGGG - Intronic
935827233 2:106963945-106963967 CTTGGTTGCCCACAGAGGAGAGG + Intergenic
936953654 2:118003108-118003130 ACAGGCTGCCCAGAAAGGAAGGG - Intronic
937094126 2:119224517-119224539 ACAGGCTGCCCGGAGAGGTGTGG + Intronic
937385090 2:121422435-121422457 ATAGCCTTTCCATAGAGGAGTGG + Intronic
937508336 2:122562549-122562571 AAAGCATGCCCAGAGACGAGAGG + Intergenic
938131822 2:128722689-128722711 AAGGGCTGCTCAGAGAGGAATGG + Intergenic
939628180 2:144504217-144504239 ATTGGATGCCTAAAGAGGAGTGG - Intronic
939658538 2:144858493-144858515 ATAAGCTTCCCACAGAGGATGGG + Intergenic
941111947 2:161425960-161425982 ACAGGCTGCCCATATTGGAGTGG - Intronic
942085841 2:172443055-172443077 ATAGGATGCCCAGAGATCAAGGG - Intronic
943317382 2:186406958-186406980 ATAGACTGGGCAAAGAGGAGTGG - Intergenic
944412481 2:199457895-199457917 AGAGGCGGCCGAGAGGGGAGAGG - Exonic
946023919 2:216660539-216660561 ATTGTCTGCCAAGAGAGGAAGGG - Exonic
946077958 2:217091488-217091510 AAGCACTGCCCAGAGAGGAGAGG + Intergenic
947269116 2:228313895-228313917 ATTTGCTGACCAGAGAGGATGGG - Intergenic
948636018 2:239338085-239338107 AGAGGCTGCTCAGAGAGCACAGG + Intronic
1168978075 20:1982886-1982908 CGAGGCAGCCCAGAGAGGGGAGG - Intronic
1169618642 20:7479091-7479113 CTAGGCTGCTGAAAGAGGAGAGG - Intergenic
1169884800 20:10387346-10387368 ACAGGATGCCCATGGAGGAGTGG + Intergenic
1171225079 20:23436040-23436062 CAAGGATGCCCAGAGTGGAGGGG - Intergenic
1172359557 20:34302823-34302845 GTAGGAGGCCCAGAGAGGGGTGG + Intronic
1172415015 20:34758071-34758093 ATATGGAGCCCAGAGAGGAGTGG + Exonic
1172832648 20:37849085-37849107 ATAGGCTGCAGAGATATGAGAGG - Intronic
1173973839 20:47172689-47172711 ATGTGCTGCGGAGAGAGGAGGGG - Exonic
1174777325 20:53356616-53356638 AAAAGCTGGCCAGGGAGGAGAGG + Intronic
1175874418 20:62222605-62222627 GGAGGCTACCTAGAGAGGAGAGG + Intergenic
1175908446 20:62393180-62393202 AAAGGATGTCCTGAGAGGAGGGG + Intronic
1175914366 20:62418904-62418926 CTAGGCAACCCAGAGAGGTGGGG - Intronic
1175942429 20:62543654-62543676 TCAGGCTGCCCACTGAGGAGGGG - Intergenic
1176023434 20:62974050-62974072 ACAGGCTGCCTAGAGTGGGGGGG - Intergenic
1176053359 20:63132315-63132337 ATAGGCAGCCCTGAGGGCAGAGG + Intergenic
1176181595 20:63752097-63752119 ACAGGCAGCCCAGAGCGGGGCGG - Intronic
1178703612 21:34854754-34854776 ACGGGCTGCCCAGAGAGCAGAGG + Intronic
1182150182 22:28022134-28022156 TTCGGCTCCCCAGAGAGCAGAGG - Intronic
1182542977 22:31055260-31055282 AAAGGAGGCCCAGAGAGGGGAGG - Intergenic
1184160029 22:42692495-42692517 ACAAGATTCCCAGAGAGGAGAGG - Exonic
1184334944 22:43847586-43847608 GGAGGCTGGCCAGAGAAGAGGGG - Intronic
950129003 3:10529022-10529044 CTGGGATGCCCAGAGAGGTGGGG - Intronic
950660330 3:14463237-14463259 GGAGACTGCCCAGAGAGGTGGGG - Intronic
952072131 3:29650055-29650077 AGAGACTGTCCAGAGAAGAGTGG + Intronic
954405995 3:50345392-50345414 AGGGGCTGCCCAGTGTGGAGGGG - Intronic
955067250 3:55544071-55544093 CAAGGCTGCCCAGGCAGGAGAGG + Intronic
957413913 3:79876266-79876288 ATAGGCTGAGCACAAAGGAGGGG + Intergenic
960713845 3:120557016-120557038 ATGGGGTGCCTAGAAAGGAGAGG - Intergenic
960968402 3:123121580-123121602 AAAGGCTGCCCAGAGACGTGAGG + Intronic
961393776 3:126571902-126571924 AAAGGCTGTTCAGAGAGCAGAGG - Exonic
962888653 3:139651950-139651972 ATATGCTGCTCAGTGAGGAAGGG - Intronic
962935216 3:140074367-140074389 ACATGCTGCCCAGAATGGAGGGG - Intronic
963130276 3:141851574-141851596 GTAGCCTGCCCGGAAAGGAGAGG + Intergenic
964529427 3:157651362-157651384 AGAGGCTGGCCAGGGAGGACAGG + Intronic
964993380 3:162844064-162844086 GCAGGCTGCCCAGACAGCAGGGG - Intergenic
965515468 3:169616782-169616804 ATAGACTGCTCAAAGAGGAAGGG + Intronic
967501561 3:190203878-190203900 CTAGGCTGCACAGAGCAGAGGGG - Intergenic
967666278 3:192175971-192175993 AGAGGCTGACTAGAGAGGAAAGG - Intronic
968675960 4:1879753-1879775 AAAGGCTTCACAGAGATGAGAGG - Intronic
971176919 4:24291032-24291054 AAGGGCTAACCAGAGAGGAGGGG - Intergenic
971296789 4:25400851-25400873 AGAGGCTGGACAGATAGGAGGGG + Intronic
973019875 4:45189337-45189359 ATAGTATTGCCAGAGAGGAGTGG - Intergenic
973826011 4:54708354-54708376 ATAGACTGACCAGGGAGTAGGGG + Intronic
973990970 4:56406762-56406784 ATTGGCTGGGCAGAGAAGAGAGG - Intronic
977347099 4:95829998-95830020 ATAGGCTGGCCTGAAAAGAGTGG + Intergenic
978135284 4:105250480-105250502 CTAGGCTTCCCAGAGAGCTGGGG + Intronic
978241755 4:106524898-106524920 GCAGGCTGCCCAGCGAGCAGTGG - Intergenic
978835970 4:113150048-113150070 ATAGGATGCCCAAGAAGGAGGGG + Intronic
981573273 4:146176083-146176105 CTAGACTGCGCGGAGAGGAGCGG + Exonic
982094503 4:151909688-151909710 ATAGGCTGCCTGGAGGGGTGAGG - Intergenic
985040524 4:185887020-185887042 ATAGGCTGCCTTGAGAGGTGAGG + Intronic
985930798 5:3056147-3056169 AGAGGCTGCTCACAGAGGAGAGG + Intergenic
992384413 5:76269987-76270009 ATAGCCTTTCCAGAGAGCAGAGG + Intronic
993671310 5:90764624-90764646 GTAGGCTGCCCATAAGGGAGGGG - Intronic
996425098 5:123305428-123305450 ATTGGATCCCCAGACAGGAGAGG + Intergenic
996595875 5:125202102-125202124 ATAGACTGTCCAAAGAGAAGAGG - Intergenic
997376260 5:133399745-133399767 TTAGGTTGCACAGGGAGGAGAGG - Intronic
997612601 5:135225716-135225738 AGAGGCTAACCAGAGAGGACAGG - Intronic
997793027 5:136779622-136779644 ATATGGAGCCCAGAGAGGGGTGG - Intergenic
998712296 5:144841020-144841042 GCAGGCTGCCCTGAGAAGAGAGG + Intergenic
999383167 5:151136018-151136040 GAAGGAGGCCCAGAGAGGAGCGG + Intronic
1001216315 5:169859116-169859138 ACAGGATGCCCACAGTGGAGAGG + Intronic
1002558968 5:180067654-180067676 ATAGGCTGGCAAGAGAAAAGGGG - Intronic
1003909785 6:10732829-10732851 TAAGGCTGCCCACAGATGAGAGG + Intergenic
1003912852 6:10758422-10758444 TAAGGCTGCCCACAGATGAGAGG + Intronic
1004343457 6:14827637-14827659 ATAAGGTGTCTAGAGAGGAGCGG - Intergenic
1005700287 6:28393871-28393893 ATAATCTTCCCAGAGAGAAGTGG - Intronic
1006146841 6:31964392-31964414 AGGGGCTGCCCAGAGGGCAGAGG + Intronic
1006436930 6:34030552-34030574 ATCTGGTGCCCAGAGAGGGGTGG - Intronic
1006752019 6:36384303-36384325 ATAGGCTGCCTCAAGAGGGGAGG + Intronic
1007763889 6:44150016-44150038 AAGTGCTGCCCAGAGAGGATGGG - Intronic
1008568369 6:52791275-52791297 ATAGGGTGGCCTGAGAGCAGAGG + Intergenic
1009727840 6:67558041-67558063 ATGCCCTGCCCAGAGAGGAGAGG + Intergenic
1012959258 6:105605404-105605426 ATAGGATGCCCACAGAAGCGTGG - Intergenic
1013983797 6:116165729-116165751 ACAGGCTGCCCCTAGAAGAGGGG - Intronic
1014232615 6:118920939-118920961 TTAGTCTCCCCAGTGAGGAGAGG + Intronic
1015388206 6:132650515-132650537 ATAGTCATCTCAGAGAGGAGAGG - Intergenic
1015940081 6:138440937-138440959 ATAGGTTGGCCAAAGAGGAAAGG + Intronic
1016868239 6:148790712-148790734 GTGGGATGCCCCGAGAGGAGAGG - Intronic
1017635571 6:156439830-156439852 ATAGACTGGGCAGAGTGGAGTGG - Intergenic
1018928774 6:168225844-168225866 TAAGGCTGCTCAGGGAGGAGTGG - Intergenic
1021098582 7:16562190-16562212 GTAGACTGCCTAGAGAGAAGAGG - Intronic
1021438853 7:20654025-20654047 ACAAGATGCCCAGAGAAGAGAGG + Intronic
1021659291 7:22903835-22903857 ATAACCTGGCCAGAGAGGGGTGG + Intergenic
1021971666 7:25971060-25971082 ATGGGTAGCCAAGAGAGGAGCGG + Intergenic
1023291479 7:38672662-38672684 ATAGGATGCACAGACAGCAGAGG - Intergenic
1024318898 7:48045814-48045836 ATAGGCAGCGCACACAGGAGGGG - Intronic
1024615756 7:51110262-51110284 AGAGGCTGCGCAGGGTGGAGGGG - Intronic
1026815133 7:73505048-73505070 ACAGGCTGGCAAGAGAGAAGAGG - Intronic
1027593532 7:80143572-80143594 AAAGGCTTTCCAGAGAGGAAAGG + Intronic
1029159364 7:98540858-98540880 CTATGCTGCCCAGAGGGCAGAGG - Intergenic
1031937718 7:127752855-127752877 ATAGGCTGCACAGAAAGGCCAGG + Intronic
1032091565 7:128914125-128914147 AGAGGCTGCCCAGGGAGCTGAGG - Intergenic
1033472784 7:141664702-141664724 GTATGCTGCCCTGATAGGAGGGG - Intronic
1035096459 7:156360068-156360090 TCAGGCTGCCCAGAGGAGAGCGG - Intergenic
1035328001 7:158077189-158077211 AGAGGCTCACAAGAGAGGAGGGG + Intronic
1035523275 8:292189-292211 ACAGGGTGGGCAGAGAGGAGAGG + Intergenic
1036616291 8:10390240-10390262 GCAGGCAGCCCTGAGAGGAGGGG + Intronic
1038152982 8:24958897-24958919 GGAGGCTGCCCAGAAAGGAGAGG + Intergenic
1039308887 8:36294362-36294384 ACAAGCTGTCCAGAGAGCAGAGG + Intergenic
1039496651 8:37985624-37985646 CTAGGCTGCCCAGAGGGTTGGGG + Intergenic
1040318386 8:46276780-46276802 AGAGGCTTCTAAGAGAGGAGAGG + Intergenic
1043383300 8:79725318-79725340 ATGGGCTGCTCAGACAGGAGAGG + Intergenic
1044591317 8:93916853-93916875 ATTGGCTGCGCAGTGACGAGTGG - Intronic
1047187753 8:122649543-122649565 ATAGGCTGCCCCTAGGGAAGAGG - Intergenic
1049790191 8:144468857-144468879 ATAGGCTGCCCAGAGAGGAGGGG - Intronic
1049803360 8:144528267-144528289 ATTGGCTGACCAGGGAGCAGAGG - Intronic
1051545380 9:18268536-18268558 ATTGTCAGCCCAGAGAGGATGGG - Intergenic
1052854411 9:33398244-33398266 ATGGGCTGGCCACGGAGGAGTGG + Intronic
1053036106 9:34827755-34827777 ATAGGCTGCCCTGAGAAGATGGG - Intergenic
1053566550 9:39258436-39258458 ATAGGATGCATAGAGAGGTGGGG - Intronic
1053682416 9:40494405-40494427 ATGGGCTGGCCACGGAGGAGTGG + Intergenic
1053932399 9:43122731-43122753 ATGGGCTGGCCACGGAGGAGTGG + Intergenic
1054130596 9:61360576-61360598 ATAGGATGCATAGAGAGGTGGGG + Intergenic
1054281298 9:63130524-63130546 ATGGGCTGGCCACGGAGGAGTGG - Intergenic
1054295515 9:63329905-63329927 ATGGGCTGGCCACGGAGGAGTGG + Intergenic
1054393535 9:64634409-64634431 ATGGGCTGGCCACGGAGGAGTGG + Intergenic
1054428184 9:65139623-65139645 ATGGGCTGGCCACGGAGGAGTGG + Intergenic
1054502196 9:65881921-65881943 ATGGGCTGGCCACGGAGGAGTGG - Intronic
1054598220 9:67091124-67091146 ATAGGATGCATAGAGAGGTGGGG + Intergenic
1056292503 9:85157828-85157850 AATGGCTGACCAGAGAGCAGAGG - Intergenic
1057315657 9:93966844-93966866 AGACGCTGCCCGGAGAGGGGAGG + Intergenic
1057785060 9:98081133-98081155 ATAGGCTGGCCTGAGAGGGATGG + Intronic
1057792658 9:98134354-98134376 ATAGCCTGCCCGGAGTGGATGGG - Intronic
1058002862 9:99884161-99884183 ATAGGCTGGCCAAAGAACAGAGG + Intergenic
1058541938 9:106020714-106020736 AGATGAGGCCCAGAGAGGAGGGG - Intergenic
1058718187 9:107740524-107740546 AGAGGTGGCTCAGAGAGGAGAGG + Intergenic
1059964650 9:119601809-119601831 CTGGGCTGCCCAGAGGAGAGAGG - Intergenic
1060997367 9:127882807-127882829 ACGGGAAGCCCAGAGAGGAGCGG + Intergenic
1187425915 X:19176916-19176938 ATAAGCTGCCCAGAGGGCCGAGG + Intergenic
1188082256 X:25858453-25858475 GTAGGCTGCCCACACAGCAGAGG - Intergenic
1190053814 X:47170661-47170683 CTGAGCTGGCCAGAGAGGAGAGG + Intronic
1190536755 X:51436451-51436473 ACAGGCTACCCAGAGAGGGAAGG + Intergenic
1191641273 X:63431475-63431497 AGAGCCTGCCCAAATAGGAGGGG + Intergenic
1196776184 X:119339963-119339985 AAAGGCTTCCCAGAGAAGGGAGG + Intergenic
1196901121 X:120384422-120384444 ACTGGCTGCCTTGAGAGGAGTGG + Intergenic
1197892343 X:131279564-131279586 ATAGGCTGCGGAGTGGGGAGGGG - Intronic
1199882458 X:151985345-151985367 ATGGGCTGCACAGAGAAGACAGG + Intergenic
1200363317 X:155634196-155634218 CTAGCCTGCCAAGATAGGAGAGG + Intronic