ID: 1049791017

View in Genome Browser
Species Human (GRCh38)
Location 8:144472773-144472795
Sequence TCGGGCTCGCTCGCCCCTCT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 46}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049791001_1049791017 22 Left 1049791001 8:144472728-144472750 CCCTGCGGAGTCTCCAGAGCACC 0: 1
1: 0
2: 1
3: 6
4: 150
Right 1049791017 8:144472773-144472795 TCGGGCTCGCTCGCCCCTCTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1049791006_1049791017 1 Left 1049791006 8:144472749-144472771 CCCGAGGCCCGGCCTTCCCCCAT 0: 1
1: 0
2: 0
3: 23
4: 230
Right 1049791017 8:144472773-144472795 TCGGGCTCGCTCGCCCCTCTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1049791005_1049791017 9 Left 1049791005 8:144472741-144472763 CCAGAGCACCCGAGGCCCGGCCT 0: 1
1: 0
2: 0
3: 20
4: 202
Right 1049791017 8:144472773-144472795 TCGGGCTCGCTCGCCCCTCTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1049791000_1049791017 28 Left 1049791000 8:144472722-144472744 CCTGAGCCCTGCGGAGTCTCCAG 0: 1
1: 0
2: 0
3: 23
4: 257
Right 1049791017 8:144472773-144472795 TCGGGCTCGCTCGCCCCTCTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1049791011_1049791017 -7 Left 1049791011 8:144472757-144472779 CCGGCCTTCCCCCATGTCGGGCT 0: 1
1: 0
2: 0
3: 14
4: 142
Right 1049791017 8:144472773-144472795 TCGGGCTCGCTCGCCCCTCTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1049791010_1049791017 -6 Left 1049791010 8:144472756-144472778 CCCGGCCTTCCCCCATGTCGGGC 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1049791017 8:144472773-144472795 TCGGGCTCGCTCGCCCCTCTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1049791007_1049791017 0 Left 1049791007 8:144472750-144472772 CCGAGGCCCGGCCTTCCCCCATG 0: 1
1: 0
2: 3
3: 19
4: 275
Right 1049791017 8:144472773-144472795 TCGGGCTCGCTCGCCCCTCTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1049791002_1049791017 21 Left 1049791002 8:144472729-144472751 CCTGCGGAGTCTCCAGAGCACCC 0: 1
1: 0
2: 1
3: 9
4: 180
Right 1049791017 8:144472773-144472795 TCGGGCTCGCTCGCCCCTCTAGG 0: 1
1: 0
2: 0
3: 0
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049791017 Original CRISPR TCGGGCTCGCTCGCCCCTCT AGG Exonic