ID: 1049794748

View in Genome Browser
Species Human (GRCh38)
Location 8:144492035-144492057
Sequence TGCCCTCCAGCTGGCTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 323}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049794748_1049794759 -3 Left 1049794748 8:144492035-144492057 CCCCCAGAGCCAGCTGGAGGGCA 0: 1
1: 0
2: 4
3: 45
4: 323
Right 1049794759 8:144492055-144492077 GCAGGCAATGTGGGGGCGCTGGG No data
1049794748_1049794761 18 Left 1049794748 8:144492035-144492057 CCCCCAGAGCCAGCTGGAGGGCA 0: 1
1: 0
2: 4
3: 45
4: 323
Right 1049794761 8:144492076-144492098 GGCTGGCCCCCAGAACCAGCCGG No data
1049794748_1049794767 26 Left 1049794748 8:144492035-144492057 CCCCCAGAGCCAGCTGGAGGGCA 0: 1
1: 0
2: 4
3: 45
4: 323
Right 1049794767 8:144492084-144492106 CCCAGAACCAGCCGGAGGGCAGG No data
1049794748_1049794758 -4 Left 1049794748 8:144492035-144492057 CCCCCAGAGCCAGCTGGAGGGCA 0: 1
1: 0
2: 4
3: 45
4: 323
Right 1049794758 8:144492054-144492076 GGCAGGCAATGTGGGGGCGCTGG No data
1049794748_1049794763 22 Left 1049794748 8:144492035-144492057 CCCCCAGAGCCAGCTGGAGGGCA 0: 1
1: 0
2: 4
3: 45
4: 323
Right 1049794763 8:144492080-144492102 GGCCCCCAGAACCAGCCGGAGGG No data
1049794748_1049794757 -10 Left 1049794748 8:144492035-144492057 CCCCCAGAGCCAGCTGGAGGGCA 0: 1
1: 0
2: 4
3: 45
4: 323
Right 1049794757 8:144492048-144492070 CTGGAGGGCAGGCAATGTGGGGG No data
1049794748_1049794769 29 Left 1049794748 8:144492035-144492057 CCCCCAGAGCCAGCTGGAGGGCA 0: 1
1: 0
2: 4
3: 45
4: 323
Right 1049794769 8:144492087-144492109 AGAACCAGCCGGAGGGCAGGTGG No data
1049794748_1049794760 1 Left 1049794748 8:144492035-144492057 CCCCCAGAGCCAGCTGGAGGGCA 0: 1
1: 0
2: 4
3: 45
4: 323
Right 1049794760 8:144492059-144492081 GCAATGTGGGGGCGCTGGGCTGG No data
1049794748_1049794762 21 Left 1049794748 8:144492035-144492057 CCCCCAGAGCCAGCTGGAGGGCA 0: 1
1: 0
2: 4
3: 45
4: 323
Right 1049794762 8:144492079-144492101 TGGCCCCCAGAACCAGCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049794748 Original CRISPR TGCCCTCCAGCTGGCTCTGG GGG (reversed) Intronic
900321211 1:2085097-2085119 TGCCCTCCCTGTGGCTCTGCGGG + Intronic
900608566 1:3534847-3534869 TGGCCCCCAGATGGCTCTGGTGG - Intronic
901198491 1:7453599-7453621 TGCCCTGCACCTGTCCCTGGAGG + Intronic
901814852 1:11788197-11788219 TGCCCTCCTTCTGGCCCTGAAGG + Exonic
901968753 1:12890572-12890594 TGTCCTCTAGCTGGATGTGGTGG + Intronic
902016420 1:13311211-13311233 TGTCCTCTAGCTGGATGTGGTGG - Intronic
902528369 1:17074520-17074542 TGACATGCAGCTGGGTCTGGTGG - Intronic
902838629 1:19061842-19061864 AGCCCTCCAGGTGGCTCTCTTGG + Intergenic
904715658 1:32465509-32465531 TGCCCTGTAGCTGGTTCTGGTGG + Intronic
904756737 1:32772158-32772180 TGACCTCCAGCGGAATCTGGTGG + Exonic
913011214 1:114685590-114685612 TGCCCTCCAGCTTTCACAGGAGG + Intronic
913345873 1:117810682-117810704 TGCCCGCTAGCTGCCTCTGGTGG + Intergenic
915558904 1:156675328-156675350 TGCCCTGCAGCTGGCTGTGGAGG - Exonic
915917965 1:159952410-159952432 TGACCTACAGCTGGCTCTCCCGG - Exonic
916698719 1:167268005-167268027 TACCCTGCAGGTGGCGCTGGTGG + Intronic
919629406 1:199945259-199945281 TGCCCTGCAGCTGATTCTGATGG - Intergenic
919807287 1:201387705-201387727 TGCCCGGCAGCAGACTCTGGAGG - Intronic
920188999 1:204180416-204180438 AGAACTCCAGCTGGCTCTGGAGG + Intergenic
920449543 1:206048843-206048865 TGCCAGCCAGCAGGCTCCGGGGG + Intronic
922574125 1:226651102-226651124 TGGCCCCCAGCTGTCTCTGGTGG - Intronic
922808452 1:228402482-228402504 TGTCCCCAAGCTGGCTCTGAAGG + Intronic
923367621 1:233278290-233278312 TGCCCTCCTCTTGGCTCTGTTGG - Intronic
1063066622 10:2616412-2616434 TGGCCTCCAGGTGGCCCTAGAGG - Intergenic
1063333271 10:5183984-5184006 TGGGCTCCAGTGGGCTCTGGTGG + Intergenic
1065246714 10:23766218-23766240 TGCCCTGCAGCTGTCACTAGTGG + Intronic
1066018707 10:31274871-31274893 TACCAGCCAGCTGGCTCTGTTGG + Intergenic
1066727607 10:38409453-38409475 TGGCCTCCATCTGGCCCTGAGGG + Intergenic
1067710832 10:48649795-48649817 TTCCCTCCAGCAGGAGCTGGTGG - Intronic
1067851477 10:49757517-49757539 TACCCTACAGATGGCTCTGCAGG + Intronic
1070601903 10:77872176-77872198 TGCGCTCCAGATGCCTCTGCTGG + Intronic
1071687288 10:87773001-87773023 TGGCCTCCAGCTTCATCTGGAGG + Intronic
1072785243 10:98275015-98275037 TGCCCTCCTGCTCTGTCTGGTGG - Intergenic
1072806615 10:98427497-98427519 TTCTCAGCAGCTGGCTCTGGGGG - Intronic
1072882003 10:99236885-99236907 TGACCTCCAGGAGGGTCTGGAGG - Intergenic
1073288538 10:102402320-102402342 AGCCCTCCTGGTGGCTCAGGGGG - Exonic
1073302686 10:102480569-102480591 TGGCCTCTGGCTGGCTGTGGGGG - Exonic
1075557260 10:123442631-123442653 TTCCCTGCAGCTGTCTCAGGTGG + Intergenic
1075795587 10:125117240-125117262 TGGCCGCCAGCTGGCTCTGCAGG + Intronic
1076622938 10:131804298-131804320 TGCCCTGTGGCTGGCTGTGGGGG + Intergenic
1076852370 10:133099368-133099390 TGCCCTCCTGGTGACTCAGGCGG - Intronic
1077173927 11:1180293-1180315 TGTCGTCCACCTCGCTCTGGAGG - Intronic
1077294749 11:1820942-1820964 TTCCCTCCATGTGGCCCTGGGGG + Intergenic
1077646022 11:3925107-3925129 TGCTTTCCAGCTGGCTGCGGTGG + Intronic
1080460305 11:32449126-32449148 TGCTGCCCAGATGGCTCTGGGGG + Intergenic
1081875987 11:46408682-46408704 TGTCCTCCATGTGGCTCTGCTGG + Exonic
1082735171 11:56847154-56847176 TGCACTCAGGCTGGCTGTGGTGG - Intergenic
1083732687 11:64661244-64661266 TGCCCTGCAGCAGGCTCAGGAGG + Intronic
1084185571 11:67469135-67469157 TGCCTTCGAGCTGTCCCTGGAGG - Exonic
1084216268 11:67648530-67648552 TGGCATCCAGCAGGCCCTGGCGG - Intronic
1084269045 11:68019497-68019519 TGGAGTCCAGCTGGCGCTGGAGG - Intronic
1084742030 11:71146260-71146282 TGGCCCCCAGCTTGCTCTGGTGG + Intronic
1084837203 11:71811559-71811581 TGCCCTCCTACAGCCTCTGGAGG + Intergenic
1085315691 11:75543563-75543585 TGCCGGCCTGCTGGCTCTGTGGG + Intergenic
1085726684 11:78960877-78960899 TCCCCTCCACCTGCCTCTAGGGG - Intronic
1087254626 11:95939933-95939955 TGCCCTGCAAATGGCTGTGGAGG - Intergenic
1087295342 11:96366601-96366623 TGCCCTCCAGCTGGCCACAGTGG + Intronic
1089306333 11:117528581-117528603 TGCTGTTCAGCTGGCTATGGGGG - Intronic
1089352217 11:117828240-117828262 TGACCTCCACCTGGCACTTGAGG + Intronic
1090450021 11:126798080-126798102 TCCTCTCCACCTGGCTGTGGTGG - Intronic
1092401499 12:8182520-8182542 TGCCCTCCTGCAGCCTCTGGAGG - Intronic
1092587277 12:9912278-9912300 AGCCAGCCAGCTGGCTCTGCAGG + Intronic
1096510632 12:52125977-52125999 TGCCAGCCAGGTGGCCCTGGGGG + Intergenic
1096848547 12:54420896-54420918 TGGGCTGCAGCTGGCTCTGGAGG - Intergenic
1097789512 12:63799576-63799598 TGCCATACAGCTGGGTGTGGTGG - Intronic
1098047069 12:66411062-66411084 TTCCTGCCTGCTGGCTCTGGAGG + Intronic
1098513861 12:71351002-71351024 TGCTCTCCAGCTGGTCCTGATGG + Intronic
1100503507 12:95196924-95196946 TGTCATCTGGCTGGCTCTGGTGG - Intronic
1100980835 12:100161071-100161093 TGCCCTGCAAGTGGCTGTGGGGG + Intergenic
1101759113 12:107644736-107644758 TACCCTCAAGCAGGCCCTGGTGG + Intronic
1102255341 12:111411736-111411758 CGCCCACCAGCTGGGGCTGGGGG - Intronic
1102324216 12:111965198-111965220 TACTCTCTAGCTGGCTCTTGAGG - Intronic
1103641376 12:122355243-122355265 TGCCCTCCAGGAGGCCCTGAAGG - Exonic
1104447245 12:128844489-128844511 GGCCCTTCCTCTGGCTCTGGAGG - Intergenic
1104876480 12:132038440-132038462 TCCCCTCTAGCTGGCTGTGTTGG + Intronic
1105477095 13:20737751-20737773 TGCTCTGCAGCTGGCACAGGAGG - Exonic
1105975832 13:25471628-25471650 TACCTTCCAGCTGGGCCTGGTGG - Intronic
1108247530 13:48532890-48532912 GGCCCCTCAGCTGTCTCTGGCGG + Intronic
1110111233 13:71748545-71748567 TGCCCTTGAGCTCACTCTGGGGG + Intronic
1113610412 13:111640778-111640800 TCTCGTCCAGCTGGGTCTGGTGG - Intronic
1113955088 13:114096077-114096099 TGCTCTCCAGGTGGCCCTGGCGG + Intronic
1113955115 13:114096167-114096189 TGCTCTCCAGGTGGCCCTGGCGG + Intronic
1114512853 14:23276743-23276765 TGCTCTGGAGCTGGCACTGGAGG + Exonic
1115307893 14:31951160-31951182 TGCCCTCTAGCTGGGGCTGTGGG + Intergenic
1121341983 14:93110923-93110945 AGCCCTCTAGCTGGCTGTGCAGG + Intronic
1121690754 14:95876113-95876135 TGGCCTCCGCCTGGCCCTGGAGG - Intergenic
1121776376 14:96593515-96593537 TAGCCTCCTCCTGGCTCTGGGGG + Intergenic
1122145630 14:99687449-99687471 AGCCCCACAGCTGGCTCTGGCGG + Intronic
1122172088 14:99885049-99885071 TGCCCTCCCTTAGGCTCTGGAGG + Intronic
1122388061 14:101362369-101362391 TACCCTTCAGCTGCATCTGGGGG + Intergenic
1122834417 14:104423944-104423966 TGCCCTCCAGCTGGGCCCAGCGG + Intergenic
1123028672 14:105440396-105440418 TGCCTGCCAGCTGGCTGTGTGGG - Intronic
1125394541 15:39232669-39232691 TGATCCCCAGCTGTCTCTGGGGG + Intergenic
1126309387 15:47298639-47298661 TGCCCTCCAGCAGGCTGCAGGGG + Intronic
1127819152 15:62640071-62640093 TGCCCTCCACCTCGCTCGGCAGG - Intronic
1129035874 15:72648114-72648136 TGCTGTCCTGCAGGCTCTGGCGG + Intergenic
1129214011 15:74089102-74089124 TGCTGTCCTGCAGGCTCTGGCGG - Intergenic
1129400001 15:75276261-75276283 TGCTGTCCTGCAGGCTCTGGCGG + Intronic
1129731146 15:77933447-77933469 TGCTGTCCTGCAGGCTCTGGCGG - Intergenic
1129978206 15:79840767-79840789 TGCACTCCAGCTGGGGTTGGGGG + Intronic
1131120913 15:89822995-89823017 TGCTCTCCTTCTGTCTCTGGAGG - Intergenic
1131559709 15:93428842-93428864 TGCCCCCAAGCAGACTCTGGGGG - Intergenic
1131969904 15:97881550-97881572 TTTCCTCCTGCTGGCACTGGTGG + Intergenic
1132089019 15:98932752-98932774 TGCCCTCCAGCTGGCATAGGTGG - Intronic
1132601396 16:774657-774679 TGCTGTCCCGCTGGCTGTGGTGG - Intronic
1132632353 16:924973-924995 TGCCCTCCAGCCGGCAGCGGGGG + Intronic
1133178228 16:4032365-4032387 TGCCCTCCACCTGCCGCAGGGGG - Intronic
1133234048 16:4379454-4379476 TGCCCTCCAGATGGCCCTGGGGG - Intronic
1133304003 16:4798820-4798842 TGGGCTCCAGCTGGGTATGGAGG + Intronic
1134090063 16:11386824-11386846 TCTCTTCCAGCTGGATCTGGAGG + Intronic
1134653078 16:15926125-15926147 TGGCATCCAGCAGGCTCTGAAGG - Intergenic
1135756095 16:25099717-25099739 TGTCATCCAGCTGGCTTTGCTGG - Intergenic
1136276291 16:29181117-29181139 TGCCACGCAGCTGGCTCTGATGG + Intergenic
1136387811 16:29940972-29940994 TGACTTTAAGCTGGCTCTGGAGG + Intronic
1137235998 16:46618792-46618814 TGTCTTCCAGCTGGATGTGGTGG - Intronic
1137610501 16:49814262-49814284 TGCCTTCCCGTGGGCTCTGGGGG + Intronic
1137943711 16:52714116-52714138 GGCTCTGCTGCTGGCTCTGGTGG - Intergenic
1138340789 16:56287760-56287782 TGCCCTCTTGCTGGCTTTGCAGG + Intronic
1138553708 16:57760441-57760463 GCCCCTCCAGCTGGCCCGGGTGG - Intronic
1139589547 16:67925994-67926016 TGCCCTCCAGGGGGTTCAGGAGG - Intronic
1140398682 16:74651582-74651604 TGCACTCCAGTTGTCACTGGGGG + Intronic
1140481313 16:75264352-75264374 GGCCCTCCAGCAGGCTCAGGTGG + Exonic
1141550631 16:84804493-84804515 TGTCCTCCACCTTGCACTGGAGG - Intergenic
1141586256 16:85035369-85035391 TGGTCTCCACCTGGCTCTGTGGG + Intronic
1141839973 16:86568031-86568053 TGCCCTGCAGCGCGCTCTCGGGG - Exonic
1142080672 16:88147176-88147198 TGCCACGCAGCTGGCTCTGATGG + Intergenic
1142137391 16:88457858-88457880 TGGACTCCAGCAGGGTCTGGCGG + Intronic
1142376431 16:89709230-89709252 TGCACTCCAGCTTCTTCTGGGGG + Exonic
1142909257 17:3072980-3073002 TGCCCACATGGTGGCTCTGGGGG - Intergenic
1142925303 17:3231258-3231280 TGCCCACATGGTGGCTCTGGGGG + Intergenic
1143614295 17:8040208-8040230 AGCCTTCCAGATGACTCTGGTGG + Intronic
1143724363 17:8835311-8835333 CGCCCTGCAGGCGGCTCTGGGGG - Exonic
1143951187 17:10633599-10633621 TGATATCCAGCTGGCTCTCGAGG - Exonic
1144189569 17:12832117-12832139 TCCCATTCAGCTGGCTCTGCAGG - Intronic
1145992933 17:29090068-29090090 GGAACTCCACCTGGCTCTGGAGG + Exonic
1146271857 17:31489932-31489954 TGCCTTCCAGCTGGCTCACCTGG - Intronic
1148245245 17:46025931-46025953 TGGCTTCCAGCTGGGACTGGGGG - Exonic
1148780533 17:50118715-50118737 TACCCTCCAACTGTCCCTGGAGG - Intronic
1149430336 17:56592624-56592646 AGCCCTGCACCTGGCGCTGGCGG - Intergenic
1149658467 17:58322671-58322693 GGCTCTCCAGCTTGCTCTGCAGG + Exonic
1151454139 17:74215969-74215991 TGCCCTCCAGTTGGCTGGGGTGG + Intronic
1151487413 17:74409925-74409947 TGCTCTCCAGCTGGGCGTGGTGG - Intergenic
1152357965 17:79815695-79815717 TGCCCTCCAGGTGGTTCTCATGG - Intergenic
1152609056 17:81306765-81306787 TGCCCTCCAACAGGCTGAGGGGG - Intergenic
1152937872 17:83151150-83151172 TGACGTCCAGCTGGGTGTGGGGG - Intergenic
1154283813 18:13032969-13032991 TGCCCTGTGGCTGGCTCTGCAGG - Intronic
1156494264 18:37515700-37515722 TGCCCTCCAGCTGGGGCATGGGG + Intronic
1156570659 18:38249087-38249109 TGCCCTCCACAGGGCTCAGGGGG - Intergenic
1157004449 18:43565160-43565182 TCCCTTCAAGCTGGCTCTTGTGG - Intergenic
1157314957 18:46579448-46579470 TGCCCTCCCAGTGGCTCTGCTGG + Intronic
1157721610 18:49929479-49929501 TGCCCGCCAGCTGCCTCCTGGGG - Intronic
1158543128 18:58374689-58374711 TGCCTTGCAGGTGTCTCTGGGGG - Intronic
1160832216 19:1109321-1109343 GGGCCTCCAGCTGGCTCTGCCGG + Exonic
1162095473 19:8307508-8307530 AACCCTCCAGCTGCCTCTAGGGG + Intronic
1162123565 19:8486946-8486968 TGCCTTGCAGCTGGCTCTGAGGG - Intronic
1162980400 19:14235602-14235624 TGCCCCCCAGATGTCTCTGCTGG + Intergenic
1163360672 19:16844129-16844151 TGCCATCCAGCTGGGTATGGTGG - Intronic
1163419430 19:17205894-17205916 TCCTCTCCAGCTGTCTCTGGGGG - Intronic
1163606884 19:18280608-18280630 TGCGCTCCAGCTTGCGCTTGCGG + Exonic
1163648167 19:18502016-18502038 CGCACTCCAGCAGCCTCTGGGGG - Intronic
1164889368 19:31810115-31810137 TGCCCTGCAGCTCTCTCTGAGGG + Intergenic
1164952216 19:32345977-32345999 TGCCCTGCAGCTGGGGGTGGGGG + Intronic
1166069326 19:40378065-40378087 TGGCCTCCAGCTGGCTCCGCAGG - Exonic
1166170910 19:41027168-41027190 TGCCGTCAAGGAGGCTCTGGTGG - Intergenic
1166178139 19:41089003-41089025 TGCCGTCAAGGAGGCTCTGGTGG + Exonic
1167235517 19:48312263-48312285 AGCCCTCCATGTGGTTCTGGTGG + Intronic
1167503750 19:49860980-49861002 GGCTCACCAGCTGGCTCTCGGGG + Intergenic
925285028 2:2710123-2710145 GGCTCTGCTGCTGGCTCTGGAGG + Intergenic
926228664 2:10986296-10986318 TGCCTTCCAGCTGGCCCTGCTGG - Intergenic
927890326 2:26744012-26744034 AGCCCTCCAGCAGGGGCTGGGGG - Intergenic
928317612 2:30258253-30258275 TCACCTCCAGCTGGCTTTGCAGG - Exonic
929570327 2:43018866-43018888 TGTCTTCCTGCTGGCTCAGGTGG + Intergenic
929830573 2:45343653-45343675 TGGCCACCAGCAGGCTGTGGGGG + Intergenic
931419193 2:62110355-62110377 TGCCCTTCAGCTGGGTGTGGTGG - Intronic
931714396 2:65017582-65017604 CTCCCTCTAGCTGGCTCTGCGGG - Intronic
932164560 2:69494291-69494313 TGGCAGCCAGCTGGCTCTGGTGG + Intronic
932418179 2:71586271-71586293 TTCCCTCAGCCTGGCTCTGGGGG + Intronic
932715652 2:74099485-74099507 TGGCTTCCAGCTGCCGCTGGCGG - Exonic
933647137 2:84821997-84822019 TGGCCACCATCTGGCTGTGGTGG + Exonic
934735163 2:96686304-96686326 TGCACTCCGGCAGGCTCTGTGGG + Intergenic
934736707 2:96693347-96693369 TGCTCTGCAGCTGACTCTGAGGG + Intergenic
935572408 2:104675928-104675950 TGCCCTCCATCTGCCTTTGGAGG - Intergenic
938636284 2:133230218-133230240 TGCCCACCAGATGCCTGTGGTGG - Intronic
938889502 2:135689122-135689144 TGCCCTCCAGGTGATTCTAGTGG + Intronic
940106059 2:150101672-150101694 GGCCCACCAGCCGGCTGTGGTGG + Intergenic
942147352 2:173039900-173039922 GGCCCTCCAGCTGGGTGTGGTGG + Intronic
942676336 2:178430219-178430241 TTCCCTGCTTCTGGCTCTGGAGG - Intergenic
946415892 2:219539445-219539467 GGCCCTCAAGCACGCTCTGGAGG + Exonic
948220774 2:236267990-236268012 GGCCCAGCAGCTGGATCTGGAGG - Intergenic
948250511 2:236524788-236524810 GGTTCTCCAGCTGGCTTTGGAGG - Intergenic
948809462 2:240467307-240467329 TGCCCTGCAGCTGGCTGGGTCGG - Exonic
949041426 2:241851669-241851691 TGCCCGCCTGCGGTCTCTGGGGG - Intronic
1168870536 20:1123795-1123817 TGCCCACCAGCAGGGACTGGAGG + Intronic
1169571516 20:6911724-6911746 TGCACAACAGCTGGCTTTGGAGG - Intergenic
1170554602 20:17505276-17505298 AGCCCTCCACGTGGCTCTGCGGG - Intronic
1170761054 20:19251881-19251903 TGCTCTCTAGCTGGCTCTGTTGG + Intronic
1171045332 20:21805231-21805253 TGCCTTCCTGCTAGCTCTGAAGG + Intergenic
1171120091 20:22560879-22560901 TGCCCTCTCGGTGGCTGTGGGGG + Intergenic
1171382656 20:24745299-24745321 CGCCCTCCAGCAGACTCTGTGGG + Intergenic
1172056201 20:32155800-32155822 TGCCCTCCACCTGGGGGTGGCGG + Intronic
1172250301 20:33474795-33474817 TACCCAGGAGCTGGCTCTGGAGG - Intergenic
1172786526 20:37472381-37472403 TGACATCCAGGTGGCTGTGGTGG + Intergenic
1172838356 20:37887286-37887308 GGCCCTGGAGGTGGCTCTGGAGG - Intergenic
1173516137 20:43666937-43666959 TGTCCTGCAGCCGGCCCTGGAGG + Intergenic
1173793742 20:45844308-45844330 TTCTCTGCAGCTGGCTCAGGGGG + Exonic
1173979111 20:47209092-47209114 TGCCCACCACCTGGCTGTGGGGG + Intergenic
1174221262 20:48957384-48957406 TGTTCTCCAGCTGGCTAGGGAGG + Intronic
1175108049 20:56628512-56628534 GGCTCTGCAGCTGCCTCTGGCGG - Intergenic
1175167081 20:57051982-57052004 TGCCTTCCAGTTGACACTGGGGG - Intergenic
1175974470 20:62703514-62703536 TGCCTTCCACCTGGCTCTGCGGG - Intergenic
1176144236 20:63558416-63558438 TGCCCTCCAGCAGCCCCTGAAGG + Intronic
1176270788 20:64234820-64234842 TGACCCCGAGCTGGCTGTGGTGG + Intronic
1176270940 20:64235295-64235317 TGACCCCGAGCTGGCTGTGGTGG + Intronic
1176271037 20:64235602-64235624 TGACCCCGAGCTGGCTGTGGTGG + Intronic
1178245207 21:30944056-30944078 TGCTCTCCAGCAGTCTCTAGTGG + Intergenic
1179800849 21:43810918-43810940 GTCCCACCAGCTGCCTCTGGGGG + Intergenic
1179881508 21:44295046-44295068 TGCCCTGGAGCTGGGTGTGGGGG + Intronic
1180088885 21:45523887-45523909 AGCAGTCCAGCTGGCTTTGGAGG - Intronic
1180231757 21:46430585-46430607 CCTCCTCCAGCTGGCTCTGCAGG - Exonic
1180850934 22:19019789-19019811 GGCCCAGCAGCTGGCTCAGGAGG + Intergenic
1180865365 22:19115533-19115555 GGCCTTGCAGCTGCCTCTGGTGG - Intronic
1181319159 22:21991420-21991442 TGTGCTCCAGCAGGCTCAGGAGG + Intergenic
1181522508 22:23457718-23457740 TGCCCTCCAGGTGGGGGTGGGGG - Intergenic
1181584506 22:23845701-23845723 GGCCCTCCAGCTTCCTCTGTTGG - Intergenic
1181588248 22:23866310-23866332 TGCCCACCAGCTGCCTCTCGGGG - Intronic
1182676311 22:32042497-32042519 TTCCCTTCTGCTGCCTCTGGAGG + Intergenic
1182779066 22:32852939-32852961 TGCTCTCCAGCTGGCTGCAGGGG + Intronic
1183074999 22:35421309-35421331 TGGCCTCCAGCTGCCTGTGGGGG - Exonic
1183259024 22:36782310-36782332 GGGCCTCCGGGTGGCTCTGGAGG - Intergenic
1183377242 22:37472430-37472452 ACCCCTCCAGGTGGGTCTGGGGG - Exonic
1183826109 22:40388970-40388992 TGCCCACCAGCTGGATGTGCTGG + Intronic
1184606633 22:45578176-45578198 TGGCCTCCAGGTGGCGCTGTTGG + Intronic
1184651111 22:45919886-45919908 GTCCATCCAGCTGGGTCTGGTGG - Intergenic
1184668725 22:46001900-46001922 TGCCCTCGTGCTGGCTCAGTGGG + Intergenic
1184668842 22:46002332-46002354 GGCTCTCCTGCTGGCCCTGGGGG - Intergenic
1184973378 22:48043490-48043512 GGCCCTCCAGCTGGAACTGTGGG + Intergenic
950186486 3:10948656-10948678 TGTCATGCAGCTGGCCCTGGTGG - Intergenic
952408302 3:33025585-33025607 TGCCATCACGCTGGCTGTGGCGG + Intronic
952408315 3:33025644-33025666 TGCCATCACGCTGGCTGTGGCGG + Intronic
952408328 3:33025703-33025725 TGCCATCACGCTGGCTGTGGCGG + Intronic
953417572 3:42731712-42731734 TTCCCTTCAGGTGACTCTGGTGG - Intronic
954326411 3:49866616-49866638 TGCCCTCCAGCTGGCTCTCATGG + Intronic
954415379 3:50390904-50390926 TGCCCACCAGCTGCCTGTGCAGG + Intronic
960015100 3:112878235-112878257 TACCCTCCAACAGGCCCTGGTGG - Intergenic
960061841 3:113330916-113330938 TTCCCTCCAGCTGGCTCGTGTGG + Intronic
960672320 3:120165621-120165643 TGCTCTCCCTGTGGCTCTGGTGG + Exonic
961511539 3:127406778-127406800 TGCCCTCCTGAGGGCTCTAGGGG - Intergenic
961678490 3:128583105-128583127 TGCACTGCAGCTGGGGCTGGAGG - Intergenic
962939120 3:140109492-140109514 TCCCTTCCTGTTGGCTCTGGAGG + Intronic
965621142 3:170643377-170643399 TGGCTCCCAGCTGGCTGTGGTGG - Intronic
966516716 3:180828548-180828570 TGCCCTCCAGCGGGGTCCGCAGG + Intronic
966865752 3:184258461-184258483 TGTGGCCCAGCTGGCTCTGGGGG + Intronic
966895747 3:184443798-184443820 TGTCCCCCAGGTGGCTCTGGAGG - Intronic
967379408 3:188840884-188840906 TGAACCCCAGCTTGCTCTGGAGG - Intronic
967494626 3:190128950-190128972 TGTCCTCCATCTGGCTGGGGTGG - Intergenic
968509427 4:988850-988872 TGGCCTCCAGCTCCCTGTGGCGG + Exonic
968670833 4:1850416-1850438 CTCACTTCAGCTGGCTCTGGTGG + Intronic
968912923 4:3485035-3485057 TGCCCTCAAGACGGCTGTGGGGG + Intronic
969042824 4:4314250-4314272 AGCCCTCCTGCTGCCTCTGATGG + Intronic
969778613 4:9379051-9379073 TGCCCTCCTACAGCCTCTGGAGG + Intergenic
972671342 4:41215918-41215940 TGGCCTCCAGCTCGGTCTGAGGG - Intronic
973639356 4:52887661-52887683 TGCCCACCTTCTGGCTTTGGTGG - Intronic
973775461 4:54237494-54237516 AGACATCAAGCTGGCTCTGGAGG + Intronic
973777207 4:54254638-54254660 CGACATCAAGCTGGCTCTGGAGG + Intronic
974014033 4:56633049-56633071 TTCCTTCCTGCTGGCACTGGTGG - Intergenic
975117368 4:70694805-70694827 TGAACTCAATCTGGCTCTGGAGG - Intergenic
976505593 4:85842764-85842786 TGCCAGCCAGCTGGCACTAGGGG + Intronic
983011798 4:162556425-162556447 TGTCCTTCAGCTGGGTGTGGTGG - Intergenic
983502162 4:168511993-168512015 TGTCACACAGCTGGCTCTGGGGG - Exonic
983648469 4:170015757-170015779 TTCACTCCAGCCTGCTCTGGTGG - Intronic
985229336 4:187798526-187798548 TGCCCTGCAGCTGCTGCTGGAGG - Intergenic
985854275 5:2412894-2412916 TGCCCTCTATCTGGCTTGGGTGG - Intergenic
985894118 5:2739062-2739084 AGCCCTCCAGCGGGTTCTGGTGG + Intergenic
986179002 5:5376156-5376178 TGCCTTCCACCTGGCCCTGATGG - Intergenic
986398992 5:7361152-7361174 TGCCCTCCTGGAGGCTCTAGGGG - Intergenic
986561020 5:9061014-9061036 TGCCCTTAAGCTGGGTCTCGAGG - Intronic
987068823 5:14316650-14316672 TGTTCTCCAGCTGCCGCTGGTGG - Exonic
992747145 5:79830710-79830732 TTCCCTCCAGCTGACTCTGCAGG - Intergenic
997327319 5:133032664-133032686 AGCCCTTTAGCTGGATCTGGTGG - Intergenic
998875482 5:146594743-146594765 CTGCCTCCAGCTTGCTCTGGTGG + Intronic
1001277521 5:170361284-170361306 TTTCCTCCAGCTGGCCCGGGAGG - Intronic
1001309850 5:170602955-170602977 TGCCATCCAGCTGGCTCACTCGG - Intronic
1002521228 5:179794199-179794221 TGCCCTCCACCTGGGCCTAGGGG - Intronic
1002846250 6:947753-947775 TGACCCCTAGGTGGCTCTGGGGG + Intergenic
1002885613 6:1290860-1290882 TGACCTCCAGCTGGGGCTGAAGG - Intergenic
1006150102 6:31982518-31982540 TGCCCTCCTGCTGCTTGTGGGGG + Intronic
1006156403 6:32015256-32015278 TGCCCTCCTGCTGCTTGTGGGGG + Intronic
1006449946 6:34099914-34099936 TGCTCCCCAGATGGCTCTGGCGG - Intronic
1007644076 6:43367402-43367424 TACCCTCCAGTTTGTTCTGGAGG - Intronic
1007697199 6:43741198-43741220 TGCCCTCATGCTGGCCCAGGAGG - Intergenic
1013395666 6:109736486-109736508 TGCCCTCTATCTGTCTCTAGTGG - Intronic
1014564008 6:122926381-122926403 CCCCCTCCAGCTGGCTCTCCAGG + Intergenic
1015499878 6:133920955-133920977 TGGCCTCCAGCAGCATCTGGTGG - Intergenic
1019588825 7:1818849-1818871 TGCCCTCCAGGTGGGGGTGGGGG + Intronic
1019886347 7:3909256-3909278 TGCTCTCCAGCAGGCTCTCTCGG + Intronic
1020036074 7:4963777-4963799 TGCCATCAACCTGGCCCTGGTGG - Intergenic
1021986457 7:26102365-26102387 AGCCCTGCAGCTGGCCCTGTAGG - Intergenic
1022252521 7:28622731-28622753 TTCCCACCAGCTGGGTGTGGTGG + Intronic
1022443533 7:30452276-30452298 TGGCCTCCAGCTGGCTCAGCAGG + Exonic
1023645726 7:42312596-42312618 TGCACTGAAGCTGGCTCTGCTGG + Intergenic
1025262223 7:57426790-57426812 TGCCGTGCCCCTGGCTCTGGTGG - Intergenic
1026632771 7:72052424-72052446 TTTACTCCAGCAGGCTCTGGGGG + Intronic
1026941570 7:74290347-74290369 TCCCCCCAAGCTGGCGCTGGTGG + Intronic
1029495321 7:100893349-100893371 TGTCCTCCAGGCGGCACTGGTGG - Exonic
1030298284 7:107950668-107950690 TGCCCTCCAGTTTTCACTGGTGG + Intronic
1031642987 7:124188767-124188789 TGCCCTCCTGCTAGTGCTGGAGG + Intergenic
1031977125 7:128101214-128101236 TGCCCTTCGCCTGACTCTGGAGG - Intergenic
1032013044 7:128359457-128359479 TCAGCTCCAGCTCGCTCTGGTGG + Exonic
1033591959 7:142816399-142816421 TGCCATGCTGCTGGCCCTGGAGG + Intergenic
1034158624 7:148976041-148976063 GGCCCTGCAGCTGGGTCTGGAGG + Intergenic
1034298827 7:149997211-149997233 CTTCCTCCAGCTGGCTGTGGTGG + Intergenic
1034807190 7:154099570-154099592 CTTCCTCCAGCTGGCTGTGGTGG - Intronic
1035260545 7:157659117-157659139 TTCCCTCCACCTGGCTCTCTGGG + Intronic
1036276057 8:7353024-7353046 TGCCCTCCTACAGCCTCTGGAGG + Intergenic
1036345292 8:7957323-7957345 TGCCCTCCTGCAGCCTCTGGAGG - Intergenic
1036637721 8:10563536-10563558 TGGCCTAGAGCTGTCTCTGGAGG - Intergenic
1036840621 8:12118090-12118112 TGCCCTCCTACAGCCTCTGGAGG - Intergenic
1036862424 8:12364335-12364357 TGCCCTCCTGCAGCCTCTGGAGG - Intergenic
1037814537 8:22104950-22104972 TGCCCTCCCGCAGTCTCTTGGGG - Intergenic
1037881426 8:22575205-22575227 TGGCCTCCAGCTGGGTGTGGGGG + Exonic
1037940197 8:22945474-22945496 TGCCCTGCAGTTTTCTCTGGAGG - Intronic
1039183890 8:34895304-34895326 TGCCCGGCCGCTGCCTCTGGGGG + Intergenic
1039966597 8:42288588-42288610 TGGCCTGCAGCTCGCTCTGCTGG + Intronic
1041472071 8:58221920-58221942 TGCCCTCCTGATGGATCTGTAGG + Intergenic
1041974421 8:63780762-63780784 TGCCCACAAGCTGTCTATGGAGG - Intergenic
1043114663 8:76235394-76235416 TGACCTCCATCTGGCTCTCCTGG + Intergenic
1043695121 8:83208096-83208118 TGCCCTGGAGCAGGCACTGGAGG - Intergenic
1043865012 8:85364873-85364895 TGCCCCTCAGCTGGCACTGCAGG - Intronic
1044137683 8:88608362-88608384 TGCCCTGCAGATGGCTGTGGGGG + Intergenic
1047977929 8:130149943-130149965 TTCCCTCCAGGCTGCTCTGGGGG + Intronic
1048738297 8:137526276-137526298 TTGGCTTCAGCTGGCTCTGGGGG + Intergenic
1049161520 8:141101325-141101347 TGCTCTCCAGCAGCCCCTGGAGG + Intergenic
1049348476 8:142151716-142151738 TGCCCTCCTGCTGGCGTTGCAGG - Intergenic
1049671700 8:143872941-143872963 GGCCCTGCAGCAGGGTCTGGTGG - Exonic
1049794748 8:144492035-144492057 TGCCCTCCAGCTGGCTCTGGGGG - Intronic
1049794764 8:144492082-144492104 TGCCCTCCGGCTGGTTCTGGGGG - Intronic
1049805644 8:144537567-144537589 GGCCCTCCAGCTCGCTCAGGAGG + Intronic
1050097642 9:2083858-2083880 TGCCCTCCCACTGTCTTTGGTGG + Intronic
1053094279 9:35310868-35310890 TTCCCTGCAGCTGGGTATGGTGG + Intronic
1053286052 9:36850170-36850192 TGCCCTGCAGCTGCCTCTGCGGG - Intronic
1057261618 9:93587696-93587718 CACCCTCCAACTGGCACTGGGGG - Intronic
1057500113 9:95590093-95590115 TGCCATCCAGGTGGCACTAGAGG - Intergenic
1057550683 9:96049366-96049388 TGGGCTCCGGCTGGCTCAGGGGG - Intergenic
1059451627 9:114374494-114374516 TGCCCACCGGTTGGCTCTGTGGG + Intronic
1059553136 9:115250619-115250641 TGCCCACTATCTGGCTTTGGAGG + Intronic
1060112023 9:120913354-120913376 CACGGTCCAGCTGGCTCTGGTGG + Exonic
1060496856 9:124125588-124125610 TGCCCTCAAGCTGGCTCTTCAGG + Intergenic
1061445431 9:130634668-130634690 TGCTCTGCGGCTGGCTCTGCTGG - Exonic
1061550818 9:131333840-131333862 TCCCCTCCACCTGCCTCTGCAGG + Intergenic
1061822993 9:133238852-133238874 AGCCCTCCAGTGGGCTCTGAGGG + Intergenic
1062167107 9:135113356-135113378 TGAGCTCCAGCAGGCTCTGAGGG + Intronic
1062167535 9:135115413-135115435 TGCCCTCCAGGTTCCCCTGGGGG + Intronic
1062260176 9:135658251-135658273 TTCCCTCCAGATAGCTCTGTGGG - Intergenic
1062358280 9:136175381-136175403 TGCCCCCCAGCTGGCCTGGGCGG + Intergenic
1062459220 9:136655897-136655919 TGCCCTACTGCTGGGGCTGGGGG - Intergenic
1062560530 9:137139696-137139718 CGCCATCCAGATGGCTCTGTCGG + Exonic
1062709958 9:137969876-137969898 TGCCCTACTGCTGCCTCTGTGGG + Intronic
1186487471 X:9944691-9944713 CGTCCTCCAGCAGGCTCTCGCGG - Exonic
1189254125 X:39624159-39624181 TGTGCTCCAGCAGGCTCAGGTGG - Intergenic
1189757110 X:44283024-44283046 TGTCCTCCAGCTGGCCGTTGGGG + Intronic
1189955194 X:46270720-46270742 TGCACTCCAGTTGCCTATGGTGG + Intergenic
1190025523 X:46918744-46918766 TGCCCTCCAGCTGGCTAGTCTGG + Intronic
1190641360 X:52484217-52484239 TCCCCTCCAGCAGCCTCTGAGGG - Intergenic
1190646312 X:52528648-52528670 TCCCCTCCAGCAGCCTCTGAGGG + Intergenic
1194586449 X:95740491-95740513 TACCCTTCAGCTGGGCCTGGTGG - Intergenic
1195448700 X:104984445-104984467 TGCCTTCAAGGTAGCTCTGGAGG + Intronic
1195667487 X:107444037-107444059 TGCCCTCCAGCTGTGTTTGCCGG - Intergenic
1196723900 X:118878814-118878836 TGCCCTCCTGGTGTCGCTGGTGG + Intergenic
1196739616 X:119013141-119013163 AGCCATCCCGCTGGCTCTGATGG - Exonic
1196919911 X:120574979-120575001 TGTCCTCCAGCTATTTCTGGAGG + Intronic
1197159739 X:123309790-123309812 TGGCCTATTGCTGGCTCTGGTGG + Intronic
1200071731 X:153532543-153532565 TCCCCTCCAGCAGCCCCTGGAGG + Intronic
1200083814 X:153592981-153593003 TTCCCTAGAGCTGGGTCTGGAGG - Intronic
1200119400 X:153783289-153783311 TGGCCTCCAGTTGGCTCAGATGG - Intronic