ID: 1049794749

View in Genome Browser
Species Human (GRCh38)
Location 8:144492036-144492058
Sequence CTGCCCTCCAGCTGGCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 580
Summary {0: 1, 1: 0, 2: 7, 3: 76, 4: 496}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049794749_1049794759 -4 Left 1049794749 8:144492036-144492058 CCCCAGAGCCAGCTGGAGGGCAG 0: 1
1: 0
2: 7
3: 76
4: 496
Right 1049794759 8:144492055-144492077 GCAGGCAATGTGGGGGCGCTGGG No data
1049794749_1049794763 21 Left 1049794749 8:144492036-144492058 CCCCAGAGCCAGCTGGAGGGCAG 0: 1
1: 0
2: 7
3: 76
4: 496
Right 1049794763 8:144492080-144492102 GGCCCCCAGAACCAGCCGGAGGG No data
1049794749_1049794769 28 Left 1049794749 8:144492036-144492058 CCCCAGAGCCAGCTGGAGGGCAG 0: 1
1: 0
2: 7
3: 76
4: 496
Right 1049794769 8:144492087-144492109 AGAACCAGCCGGAGGGCAGGTGG No data
1049794749_1049794762 20 Left 1049794749 8:144492036-144492058 CCCCAGAGCCAGCTGGAGGGCAG 0: 1
1: 0
2: 7
3: 76
4: 496
Right 1049794762 8:144492079-144492101 TGGCCCCCAGAACCAGCCGGAGG No data
1049794749_1049794758 -5 Left 1049794749 8:144492036-144492058 CCCCAGAGCCAGCTGGAGGGCAG 0: 1
1: 0
2: 7
3: 76
4: 496
Right 1049794758 8:144492054-144492076 GGCAGGCAATGTGGGGGCGCTGG No data
1049794749_1049794767 25 Left 1049794749 8:144492036-144492058 CCCCAGAGCCAGCTGGAGGGCAG 0: 1
1: 0
2: 7
3: 76
4: 496
Right 1049794767 8:144492084-144492106 CCCAGAACCAGCCGGAGGGCAGG No data
1049794749_1049794761 17 Left 1049794749 8:144492036-144492058 CCCCAGAGCCAGCTGGAGGGCAG 0: 1
1: 0
2: 7
3: 76
4: 496
Right 1049794761 8:144492076-144492098 GGCTGGCCCCCAGAACCAGCCGG No data
1049794749_1049794760 0 Left 1049794749 8:144492036-144492058 CCCCAGAGCCAGCTGGAGGGCAG 0: 1
1: 0
2: 7
3: 76
4: 496
Right 1049794760 8:144492059-144492081 GCAATGTGGGGGCGCTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049794749 Original CRISPR CTGCCCTCCAGCTGGCTCTG GGG (reversed) Intronic
900321210 1:2085096-2085118 CTGCCCTCCCTGTGGCTCTGCGG + Intronic
900766693 1:4510694-4510716 CTCCTCCCCAGCTGGTTCTGTGG - Intergenic
900919953 1:5663733-5663755 ATGACCTACAGCTGCCTCTGTGG + Intergenic
902482458 1:16718983-16719005 CTGGCCTCCAGCTTGCTCCCTGG + Intergenic
902533141 1:17103257-17103279 CTCCCCTCCTGCTGGCTGAGAGG + Intronic
902635112 1:17729806-17729828 TTGGCCTCCATCTGGCTGTGTGG + Intergenic
903263868 1:22144925-22144947 CTGTCCTCGGGCTGGATCTGCGG + Intergenic
903447427 1:23431287-23431309 CTGACCTCCAGAAGACTCTGTGG + Intronic
904043299 1:27596314-27596336 CTGCCCTCCAGGCAGCTTTGTGG - Intronic
904093588 1:27961140-27961162 CTGCCCTCTTGCTGGGTCTGGGG - Intronic
904212244 1:28893651-28893673 CTGCCCTCCCTCTGCCTCTGGGG - Intronic
904401516 1:30259807-30259829 CTGCCCTCCAGGTCGCCCTGGGG + Intergenic
904997125 1:34639827-34639849 CCGCCCCCCAGCAGGCACTGTGG + Intergenic
905208667 1:36358187-36358209 CTCACCTCTGGCTGGCTCTGTGG - Intronic
905257497 1:36694395-36694417 CTTGCCTCCATCTGGCTCTGCGG + Intergenic
905313322 1:37065587-37065609 CTGCCCTCCTGCTGGCCTGGTGG + Intergenic
905740084 1:40362352-40362374 CAGCCCTTCAACTGGCTCTGAGG - Intronic
906034625 1:42742414-42742436 CAGGCCTCCTGCTGGCTCTGTGG - Intergenic
906087538 1:43148644-43148666 CTTTCCTCCTGCTGGGTCTGAGG - Intronic
906116053 1:43358214-43358236 CTGCCCTACAGGAGGCACTGTGG - Intergenic
909300772 1:74010478-74010500 CAGTCCTCCAGCTGTCTCTCAGG + Intergenic
910263554 1:85314591-85314613 CTGCTCTCTGGCTGGGTCTGTGG + Intergenic
911323149 1:96439204-96439226 CTGCCCTGCAGTTGGATCTCAGG + Intergenic
912516835 1:110221669-110221691 CTGACTTCCACCTGGCTGTGTGG - Intronic
912925964 1:113913130-113913152 CTTCCCGCCAGCTGGCTCCTTGG - Exonic
913396934 1:118381765-118381787 CTGGCTTCCAGATGGATCTGGGG - Intergenic
915204230 1:154257544-154257566 AAGCCCTGCAGTTGGCTCTGTGG + Intronic
915624736 1:157107641-157107663 GTGCCCAACACCTGGCTCTGTGG + Intergenic
915896259 1:159813513-159813535 CTGCTCTCCACCTGGAGCTGTGG - Exonic
917624464 1:176831544-176831566 CTGCCCTCCTCCTGGCCTTGAGG + Intronic
917969278 1:180196837-180196859 CGGGCCTCCAGCTGGCCCTCAGG - Exonic
918217891 1:182408935-182408957 CTGGCCTCCTGCTGGAGCTGGGG - Intergenic
919252276 1:195071777-195071799 CTGGCCTCCTGCTAACTCTGGGG + Intergenic
919550363 1:198977862-198977884 CTGCCCTCTGGCTGGCGCAGTGG - Intergenic
919768409 1:201141856-201141878 CTGCCCTCCCTCTGGCTCCCTGG + Intronic
920000609 1:202796151-202796173 CTGGCCACCAGCGGGCACTGAGG - Intronic
920182928 1:204143607-204143629 TTCCCCTCCTGCTGGCCCTGGGG - Intronic
920364110 1:205439097-205439119 ATGCCCTCCAGGAGGCTCTCTGG + Intronic
920398539 1:205663095-205663117 CAGCCCTTCTGCTGGCTCGGTGG + Exonic
920449542 1:206048842-206048864 CTGCCAGCCAGCAGGCTCCGGGG + Intronic
920847919 1:209608966-209608988 CTGTCCTGCTGCAGGCTCTGTGG + Exonic
922616199 1:226962625-226962647 CCGCCCTCCTGCAGGCTGTGAGG + Intronic
922942430 1:229479191-229479213 AAGTCCTGCAGCTGGCTCTGTGG + Intronic
923100133 1:230807591-230807613 CTTACCTCCAGCTAGCTGTGTGG + Intergenic
923440798 1:234018352-234018374 CCTCCATTCAGCTGGCTCTGAGG + Intronic
923506688 1:234610773-234610795 CTCCCCTCCAGAGGGCTCCGTGG - Intergenic
923967350 1:239156429-239156451 CTTCCTTCCACCTGGCTATGGGG + Intergenic
924418275 1:243882651-243882673 CTTCTCAGCAGCTGGCTCTGCGG - Intergenic
1062837009 10:642260-642282 CTGCCCTCCAGGTGGGTCTGAGG - Intronic
1062888594 10:1038632-1038654 CTGCCCTCCACCTGCCCCTTAGG - Intergenic
1063072596 10:2680957-2680979 CTGCCTTGCAGCTGCCTGTGTGG - Intergenic
1065000086 10:21330592-21330614 CTGTCTTCCAGCAGGCTGTGAGG - Intergenic
1065942553 10:30578063-30578085 CTGACCCCCAGGTGGGTCTGTGG - Intergenic
1066067671 10:31774124-31774146 CTGTCCTCCTGCCAGCTCTGGGG + Intergenic
1066727606 10:38409452-38409474 CTGGCCTCCATCTGGCCCTGAGG + Intergenic
1067665151 10:48271207-48271229 CTGTCCTTCTGCAGGCTCTGTGG + Intronic
1067692443 10:48510514-48510536 ATGCCCTCCAGCTGTCTCAGAGG + Intronic
1067734335 10:48837660-48837682 CTGGCATTCAGATGGCTCTGTGG + Intronic
1067819957 10:49519835-49519857 CTGAGCTCCCGCTGACTCTGAGG - Intronic
1069286403 10:66720869-66720891 CTGCTCTCCAGTAGCCTCTGAGG + Intronic
1069721318 10:70551315-70551337 GTGGCCTCCAGCAGGGTCTGTGG + Intronic
1069860624 10:71468916-71468938 CTGCCCTCAGGCTGGCTCTCAGG + Intronic
1069989228 10:72304282-72304304 TAGCCCTCCAGGTAGCTCTGAGG - Intergenic
1070060837 10:72981440-72981462 CTGCCATGCAGCTGTGTCTGTGG - Intergenic
1070077734 10:73154384-73154406 CTTCCTTCCAGCTGGCATTGTGG - Exonic
1070191085 10:74112588-74112610 CTGCCCTGCACTTGGCTATGTGG + Intronic
1070776082 10:79110691-79110713 CTGCACCACAGCTGGCTCAGAGG + Intronic
1070797114 10:79223299-79223321 CTGCCTGCCTGCTGTCTCTGGGG - Intronic
1071515632 10:86294911-86294933 CCTCCCTCCTCCTGGCTCTGTGG - Intronic
1072740843 10:97908188-97908210 CTGTCCTCCAGGTGGGCCTGGGG - Intronic
1074530093 10:114291146-114291168 CAGCCCTCCAGCAGCCTCTGAGG - Intronic
1075066280 10:119291125-119291147 ATACCCTGCGGCTGGCTCTGGGG - Intronic
1075533817 10:123253914-123253936 ATGCCCTGCCACTGGCTCTGTGG - Intergenic
1075659628 10:124184403-124184425 CTCCTCTCCAGCTGACACTGTGG - Intergenic
1076168800 10:128303416-128303438 CTCCCTCCCTGCTGGCTCTGAGG + Intergenic
1076244041 10:128932430-128932452 CTGCCCTTTCTCTGGCTCTGAGG + Intergenic
1076402361 10:130192501-130192523 CTGCCCTTCAGGTGGCCCTGTGG + Intergenic
1076544852 10:131238423-131238445 CAGCCCTGCAGCTGGCTCCTGGG - Intronic
1076611346 10:131727728-131727750 GTGTCCTTCAGGTGGCTCTGGGG - Intergenic
1076622937 10:131804297-131804319 CTGCCCTGTGGCTGGCTGTGGGG + Intergenic
1076748137 10:132524650-132524672 CAGTCCTCCCGCTGGCCCTGGGG - Intergenic
1077052094 11:571530-571552 CAGGCATCCACCTGGCTCTGGGG + Intergenic
1077294748 11:1820941-1820963 CTTCCCTCCATGTGGCCCTGGGG + Intergenic
1077306020 11:1869006-1869028 CTGCCCTCCAGAGACCTCTGTGG - Intronic
1077442570 11:2575411-2575433 CTGCCCTGCAGCTGTCTGGGGGG + Intronic
1077454078 11:2667497-2667519 TTGCCCTCCAGCCACCTCTGTGG - Intronic
1077529110 11:3086864-3086886 ATGCCCCCCAGCAGCCTCTGAGG + Intergenic
1077940255 11:6833415-6833437 CAGCCCTTCAGCTGTCCCTGAGG + Intergenic
1078417463 11:11177643-11177665 CTGCACTCCTGCTGCCACTGAGG + Intergenic
1079256436 11:18835116-18835138 CTGGCCTCCAGCAGCCTGTGTGG + Intergenic
1079588020 11:22149922-22149944 CTTTCCCCCTGCTGGCTCTGAGG - Intergenic
1080409977 11:32014266-32014288 CTGCCTTCCCACTGGCTATGTGG - Intronic
1080614912 11:33937401-33937423 CTCCTCTCCAGCTGGCCGTGGGG - Intergenic
1080773619 11:35365349-35365371 CTGCCATCAGCCTGGCTCTGAGG + Intronic
1081340107 11:41917656-41917678 CTTTCCTCCTGCTAGCTCTGAGG - Intergenic
1081617961 11:44601589-44601611 CTGCCCTGCAACTGGCGCAGTGG + Intronic
1081766349 11:45613277-45613299 CTTCCCTCCAACTTGATCTGTGG + Intergenic
1083431672 11:62616567-62616589 CTGCTCTCCAGGTGGCCCCGGGG + Exonic
1083571498 11:63764150-63764172 CCGCCCACCTGCTGGCCCTGGGG - Exonic
1083840556 11:65301938-65301960 CGGCAGTCCAGCTGGGTCTGAGG - Intronic
1083890890 11:65595338-65595360 CTGGGCTCCATCTGGCTCTTTGG + Intronic
1083998373 11:66283257-66283279 CCGTCCTGCAGATGGCTCTGAGG + Exonic
1084943909 11:72628836-72628858 TTTCCCTCCAGCTGCCCCTGTGG + Intronic
1085315690 11:75543562-75543584 CTGCCGGCCTGCTGGCTCTGTGG + Intergenic
1086301554 11:85431727-85431749 CTTTCCTCCTGCTAGCTCTGAGG + Intronic
1087102885 11:94381873-94381895 CTGCCCCACAGGAGGCTCTGGGG - Intronic
1087893324 11:103559966-103559988 CAGCCCTCCAAATGTCTCTGTGG - Intergenic
1088229459 11:107659168-107659190 CTGCCCTCCAACCTGCTCTTAGG - Intronic
1089100885 11:115961529-115961551 CCCCTCTCCAGCTGGCTCTGAGG + Intergenic
1089461777 11:118658163-118658185 CTGCCCTCCACTTCGCTCTGAGG + Exonic
1089528013 11:119109333-119109355 CTGCTCTCCAGGTGGGGCTGCGG + Intronic
1090028465 11:123187207-123187229 CTGGCTTCCAGCAGGGTCTGGGG + Intronic
1091140539 11:133230724-133230746 ATGGGCTCCAGCTGGCCCTGAGG - Intronic
1091206894 11:133827781-133827803 CTGCCCACCAGCTGCTCCTGAGG - Intergenic
1091448474 12:558373-558395 CTGCCCAGCAGCTGGTTTTGTGG + Intronic
1091592116 12:1848963-1848985 GCCTCCTCCAGCTGGCTCTGGGG + Intronic
1091786618 12:3246797-3246819 CTGCCATCCAGGTGGCTCAGAGG + Intronic
1091930643 12:4392637-4392659 CTGACCTCCAGCAGGCTGAGGGG - Intergenic
1092247317 12:6871024-6871046 CCTCCCTCCAAGTGGCTCTGGGG + Exonic
1094134380 12:27108598-27108620 GAGCCCTCCCACTGGCTCTGAGG - Intergenic
1094184491 12:27626471-27626493 AAGCCCTCCCACTGGCTCTGAGG - Intronic
1096540968 12:52306919-52306941 CTGCCCTCCAGCTGTATCGCTGG - Intronic
1096638664 12:52977035-52977057 CTGACCTCCTGCTGGCTATGTGG + Intergenic
1096873778 12:54611578-54611600 CTGCTCTCCAGATGCCTCTCTGG - Intergenic
1096983902 12:55744136-55744158 CTGCAGTCCAGCTGGGGCTGCGG - Intronic
1097008607 12:55936642-55936664 CTGCCCCCCAGCTTCCTCAGTGG + Intronic
1097153394 12:56995552-56995574 CTGGACTACACCTGGCTCTGGGG + Exonic
1097271837 12:57780318-57780340 CTGGCCTCCAGCTGGCACATTGG - Exonic
1097529489 12:60780750-60780772 CTTTCCTCCTGCTAGCTCTGAGG - Intergenic
1097580474 12:61449656-61449678 CTGCACTCCAGCAGCCTGTGTGG + Intergenic
1099300406 12:80887466-80887488 CTGCTCTCCAGCTACCTCTATGG + Intronic
1099851827 12:88108449-88108471 CTGCCCTACAACTAGCTTTGTGG + Intronic
1100619623 12:96258711-96258733 CTGCCCTCCTGCTGGCTTGCAGG + Intronic
1100980834 12:100161070-100161092 CTGCCCTGCAAGTGGCTGTGGGG + Intergenic
1101299818 12:103467539-103467561 CTACCCTCCAGCGGGTCCTGAGG - Intronic
1101415422 12:104504429-104504451 CTGCCCACCTGCTGCCACTGAGG - Intronic
1101747400 12:107553574-107553596 CTTCCTTCCAGCTTGGTCTGGGG - Intronic
1102028487 12:109726847-109726869 TTGCCTTGCACCTGGCTCTGAGG + Intronic
1102666494 12:114578383-114578405 CTGCCCTCCACCTTGTTCTCAGG + Intergenic
1104627083 12:130366364-130366386 CTGCCCTCCCTCTGACCCTGCGG - Intronic
1104863939 12:131941675-131941697 CTGCGCTCCAGCACGCTCTCAGG - Exonic
1105008700 12:132739750-132739772 CAGCCCTGTAGCAGGCTCTGTGG + Intronic
1105024290 12:132838227-132838249 CTCCCATCCTGCTGGCCCTGAGG + Intronic
1105668424 13:22586424-22586446 CTTTCCTCCTGCTAGCTCTGTGG - Intergenic
1106522072 13:30506769-30506791 GTGCGCTCCTGCAGGCTCTGGGG + Intronic
1108176547 13:47798454-47798476 CAGCCTTCCAGCAGGCTGTGGGG + Intergenic
1108323252 13:49306312-49306334 GTCCCCTGCAGCTGGCACTGGGG - Intergenic
1108689534 13:52848569-52848591 CGAGCCTCCAGCGGGCTCTGAGG + Exonic
1110836895 13:80093675-80093697 CTTTCCTCCTGCTAGCTCTGAGG - Intergenic
1111045216 13:82805622-82805644 CTTTCCTCCTGCTAGCTCTGAGG + Intergenic
1112265498 13:97919891-97919913 CAGCCCTCCTGCTGGTTCTCTGG - Intergenic
1113462492 13:110491936-110491958 CTCTCCTCCAACTGGCACTGCGG + Intronic
1113708400 13:112448411-112448433 CTGCCATCCAACTGCGTCTGGGG + Intergenic
1114039887 14:18668028-18668050 CTTCCCTCCACCTGGCCCTTGGG + Intergenic
1114670993 14:24411008-24411030 CTGCCCCAGGGCTGGCTCTGAGG + Intronic
1115307892 14:31951159-31951181 CTGCCCTCTAGCTGGGGCTGTGG + Intergenic
1116685660 14:48035694-48035716 CTTCCCTCCTGCTAGCTCTGAGG - Intergenic
1116939610 14:50778074-50778096 CTGGCCACCAGATGGCACTGTGG - Intronic
1119018727 14:71086740-71086762 GTGAGCTCCAGCTGGCTCAGAGG + Intronic
1119095695 14:71828694-71828716 TTGGCATTCAGCTGGCTCTGAGG - Intergenic
1119134220 14:72202385-72202407 CTGCCCTCCAGATTCCCCTGTGG + Intronic
1119319091 14:73718873-73718895 CCGCCCACCAGCAGGCCCTGCGG - Exonic
1119325349 14:73756790-73756812 CTGCCCTGTAGCTGGCCTTGTGG - Intronic
1119895506 14:78216334-78216356 TTGTCCTCCAGATGTCTCTGTGG + Intergenic
1120368967 14:83607721-83607743 CTTTCCTCCGGCTGGCTCTGGGG - Intergenic
1121142446 14:91555203-91555225 CTTTCCCCCTGCTGGCTCTGTGG + Intergenic
1121281527 14:92702551-92702573 CTGCCCTACACCAGGCACTGGGG - Intergenic
1121553735 14:94820825-94820847 TTGCCCTCCAGCTTCCTGTGGGG - Intergenic
1121622830 14:95362011-95362033 CTGCCCTCCTGGAGGCACTGGGG + Intergenic
1122250835 14:100438566-100438588 CTGCCCTGTAGGTGGCTATGGGG + Intronic
1122388060 14:101362368-101362390 CTACCCTTCAGCTGCATCTGGGG + Intergenic
1122597292 14:102902450-102902472 CTACCCTGCTGCTGGGTCTGGGG - Intronic
1122718270 14:103708000-103708022 CTCCCCTGCAGGTGGCTCAGTGG - Intronic
1122902750 14:104788557-104788579 CAGCCATCCAGCTGGTCCTGGGG - Intronic
1123028673 14:105440397-105440419 TTGCCTGCCAGCTGGCTGTGTGG - Intronic
1123099865 14:105790430-105790452 CTGCCCTACTGGAGGCTCTGTGG - Intergenic
1123144735 14:106117560-106117582 CTGCCCTGGAGCTGTCTCAGGGG - Intergenic
1124346065 15:28922339-28922361 CTGCCCTGCTGCTGCCCCTGGGG - Intronic
1124423410 15:29541595-29541617 CTGCCCTTAAGCTGACTCCGAGG - Intronic
1124458922 15:29871013-29871035 CTGCTCTCCAGCTAGCGTTGAGG - Intronic
1125932527 15:43610765-43610787 CTGTCCTGCATCTGGCACTGGGG + Intronic
1125945625 15:43710237-43710259 CTGTCCTGCATCTGGCACTGGGG + Intergenic
1126309386 15:47298638-47298660 CTGCCCTCCAGCAGGCTGCAGGG + Intronic
1127170098 15:56292309-56292331 CTGCCTTCCAGCTGCCACAGAGG - Intronic
1127598804 15:60514406-60514428 CAGCCAGCCAGCTGACTCTGAGG + Intronic
1127896158 15:63301043-63301065 CAGCCCTCCAGGTGATTCTGAGG - Intronic
1128535413 15:68486560-68486582 CTTCCTGTCAGCTGGCTCTGGGG + Intergenic
1128861682 15:71079515-71079537 CTGCCTTCCAACTGGCTCTGGGG + Intergenic
1129244666 15:74272030-74272052 CTGCCCTCCAGCTTGCTCTCAGG - Intronic
1129457216 15:75682409-75682431 CTGCGCTGGAGCTGGCCCTGAGG + Exonic
1129692885 15:77723782-77723804 ATGCCCCCCAGCTGGGGCTGGGG - Intronic
1129697674 15:77749832-77749854 CAGCCCTCAAGCTGGCCCTTGGG - Intronic
1129726568 15:77904532-77904554 CTGCGCTGGAGCTGGCTCTGAGG - Intergenic
1129978205 15:79840766-79840788 CTGCACTCCAGCTGGGGTTGGGG + Intronic
1130910630 15:88268445-88268467 CTTCTCTCCAGCTGACTCTTGGG + Intergenic
1131559710 15:93428843-93428865 CTGCCCCCAAGCAGACTCTGGGG - Intergenic
1131597603 15:93813747-93813769 CTGCCATCCAGGTGTTTCTGGGG - Intergenic
1132386169 15:101401532-101401554 CGTCCCTCCTGCTGGCTCCGAGG - Intronic
1132525318 16:411350-411372 CTGCCCTCCAGGTGGCCCTCAGG + Exonic
1132658500 16:1051347-1051369 CTGGCCTGGTGCTGGCTCTGAGG + Intergenic
1132930078 16:2454557-2454579 CCGCCCTCCACCAGGCCCTGGGG + Intronic
1133178229 16:4032366-4032388 CTGCCCTCCACCTGCCGCAGGGG - Intronic
1133234049 16:4379455-4379477 GTGCCCTCCAGATGGCCCTGGGG - Intronic
1133285850 16:4690355-4690377 CTGCCCTGCAGCTGGGCCTGGGG + Exonic
1134622889 16:15702957-15702979 CTGCTCTCTGGCTGGCTGTGGGG + Intronic
1134993832 16:18723763-18723785 ACGCCCTCCACGTGGCTCTGAGG + Intergenic
1136787648 16:32945294-32945316 CTGCCCCCCGGCTCGCTGTGGGG + Intergenic
1136882130 16:33908495-33908517 CTGCCCCCCGGCTCGCTGTGGGG - Intergenic
1137392641 16:48093990-48094012 TTGTTCTCCAGCTGGCTCTGTGG - Intronic
1137555414 16:49467364-49467386 CTCCCCTGCAGATGGCTATGAGG - Intergenic
1137610500 16:49814261-49814283 CTGCCTTCCCGTGGGCTCTGGGG + Intronic
1137838428 16:51617223-51617245 CTTCAATCCAGCTAGCTCTGTGG - Intergenic
1138179048 16:54930283-54930305 CGGATCTCCAGCTGGCTCTCCGG + Intergenic
1138489875 16:57370591-57370613 GTCCCAGCCAGCTGGCTCTGAGG - Intergenic
1140398681 16:74651581-74651603 CTGCACTCCAGTTGTCACTGGGG + Intronic
1140732608 16:77870383-77870405 TTGCTCTCCAGCTGGGTCTTTGG - Intronic
1141586255 16:85035368-85035390 CTGGTCTCCACCTGGCTCTGTGG + Intronic
1141627044 16:85266844-85266866 CTCCCCACCAGCTGGTTGTGTGG - Intergenic
1141651841 16:85397023-85397045 CTCCCCTCCAGCTGGGTGGGTGG + Intergenic
1141839974 16:86568032-86568054 CTGCCCTGCAGCGCGCTCTCGGG - Exonic
1141980590 16:87547681-87547703 CTGGCCTCTGGCTGGCTGTGGGG - Intergenic
1142110808 16:88330068-88330090 CTGACCTCCCTCTGCCTCTGAGG - Intergenic
1142149415 16:88506093-88506115 CTGGCCTCCAGGGTGCTCTGAGG + Intronic
1203089879 16_KI270728v1_random:1206951-1206973 CTGCCCCCCGGCTCGCTGTGGGG + Intergenic
1142599616 17:1047226-1047248 CTGCCCGCCAGCAGGCGCTGAGG - Intronic
1142900450 17:3008238-3008260 CACCCCTCCAGCTGGCCCTTGGG - Intronic
1143001175 17:3796226-3796248 CTGGGCACCAGCTGGCTCTCAGG - Intronic
1144923369 17:18782608-18782630 CAGCCCTCCAGGTTGCTCTATGG - Intronic
1144951135 17:18994039-18994061 CAGCCTTCCAGCTGGCCCGGAGG - Intronic
1147148003 17:38497414-38497436 CTGCCCCCCGGCTCGCTGTGGGG + Intronic
1147308411 17:39579185-39579207 GTGCCCCCAAGGTGGCTCTGAGG + Intergenic
1147339833 17:39746745-39746767 CGGCCCTCCTCCTCGCTCTGGGG - Exonic
1147582940 17:41637081-41637103 CTGGGCTCCAGCAGCCTCTGGGG - Intergenic
1149027509 17:52045528-52045550 TTGCCCTCCTCTTGGCTCTGTGG - Intronic
1149231914 17:54544638-54544660 CTTTCCTCCTGCTGGCTCTGAGG + Intergenic
1150517217 17:65826343-65826365 CTGCCCTACAGCCTGCACTGAGG - Intronic
1151726603 17:75888686-75888708 CTGCCCGCCTCCTGGCTGTGGGG + Intronic
1152048558 17:77955319-77955341 CAGCCCTCCAGATGATTCTGAGG - Intergenic
1152308152 17:79533145-79533167 CTGCCCACCAGCTGGTTCTTAGG - Intergenic
1152609057 17:81306766-81306788 CTGCCCTCCAACAGGCTGAGGGG - Intergenic
1152715884 17:81900477-81900499 CCTCCCTCAGGCTGGCTCTGAGG + Intronic
1152740540 17:82016581-82016603 CTCCCGGGCAGCTGGCTCTGAGG - Intronic
1153263773 18:3247961-3247983 CCGCCCTCCAGCTGCCCCCGCGG - Intronic
1153736491 18:8074513-8074535 CTTCCCTCCAGCAGGGTATGGGG + Intronic
1154161201 18:11981734-11981756 CGGCCGTGCAGCTGGCGCTGCGG + Exonic
1155182355 18:23358792-23358814 CTAGTTTCCAGCTGGCTCTGTGG + Intronic
1155199940 18:23508370-23508392 CTCCACTCCAGGTGGCTGTGAGG - Intronic
1156364155 18:36409811-36409833 CTGCCCTGAAGGTGGCTTTGGGG + Intronic
1156399038 18:36724395-36724417 CTGCCCACCAGCTGAATCTGGGG + Intronic
1156494263 18:37515699-37515721 CTGCCCTCCAGCTGGGGCATGGG + Intronic
1157114586 18:44851170-44851192 CTGTCCTTCAGATGGCTCTTGGG - Intronic
1158524221 18:58197880-58197902 CTTCCCTCAAGCAGGCTCAGGGG - Intronic
1158662623 18:59402400-59402422 CTGCTCTCCTGCAGGCTCTTGGG - Intergenic
1159924659 18:74257228-74257250 CTGCCCTCCTGCTGCCTTTGTGG + Intronic
1160005018 18:75063268-75063290 CTGGCCTCCTGCTGCTTCTGAGG - Exonic
1160293943 18:77620890-77620912 CAAACCTCCAGCTGGCCCTGTGG - Intergenic
1160525045 18:79530918-79530940 CTGGGCTCCACTTGGCTCTGAGG - Intergenic
1160702562 19:514992-515014 CAGCCCTGCTGCCGGCTCTGGGG - Intronic
1160791076 19:924046-924068 CTGCCCTCCAGGTGCCTTTCGGG + Intergenic
1161108356 19:2455574-2455596 GGGGCCTCCAGCTAGCTCTGGGG - Intronic
1161319974 19:3636624-3636646 CTGGCTTCCCGCTGGCTCCGTGG + Intronic
1161436553 19:4267136-4267158 CTTCCCCACTGCTGGCTCTGCGG - Intronic
1162020324 19:7865283-7865305 CTGCCCTGTGCCTGGCTCTGAGG + Intergenic
1162095472 19:8307507-8307529 CAACCCTCCAGCTGCCTCTAGGG + Intronic
1162123566 19:8486947-8486969 ATGCCTTGCAGCTGGCTCTGAGG - Intronic
1163419431 19:17205895-17205917 TTCCTCTCCAGCTGTCTCTGGGG - Intronic
1163772358 19:19198757-19198779 CAGCACTCCAGCGGGCCCTGCGG + Intronic
1163886090 19:19966170-19966192 CTTTCCTCCTGCTTGCTCTGAGG - Intergenic
1164121175 19:22266447-22266469 CTGTTCTCCAGCTTTCTCTGTGG + Intergenic
1164449953 19:28352018-28352040 CTGCCCTGCACCTCACTCTGGGG + Intergenic
1164731519 19:30508556-30508578 CTGCCTTCCAGCCTTCTCTGTGG - Intronic
1164889367 19:31810114-31810136 CTGCCCTGCAGCTCTCTCTGAGG + Intergenic
1165347701 19:35259146-35259168 CTGCCCTCCAGCTTACCCTCTGG + Intronic
1167115536 19:47487322-47487344 CGACCCTCCCACTGGCTCTGAGG + Intergenic
1167492971 19:49802454-49802476 CTGCCCTCTCGCTGCCTATGTGG + Intronic
1168249515 19:55133829-55133851 CTACCCTCCCGCTGACTCTCAGG - Intronic
1168363038 19:55759131-55759153 CTGGCCTCCAGCTGCTTCTGCGG - Exonic
1168363990 19:55769131-55769153 CTGGCCTCCAGCTGCTTCTGCGG - Exonic
1168671096 19:58241833-58241855 CTGTCCTCCCCCTGGCACTGAGG + Intronic
925214969 2:2086637-2086659 CTGCCCTGCTGTTGGTTCTGAGG + Intronic
925251768 2:2445003-2445025 CGCCCCTGCAGCTGGCTTTGAGG - Intergenic
926124798 2:10265458-10265480 CTGGCCTCAAGCTGACCCTGGGG - Intergenic
926272774 2:11379049-11379071 ATGGCCTCCTGCAGGCTCTGGGG - Intergenic
926928286 2:18010425-18010447 CTGACATCCAGCTGGCACAGAGG + Intronic
927190860 2:20516045-20516067 CTGCCATCTACCTGGCACTGTGG + Intergenic
927295572 2:21449252-21449274 CTGCCCTGCAGTTAGCCCTGAGG + Intergenic
927856101 2:26528905-26528927 CTGCCCTGCAGATGCCACTGGGG - Intronic
927865527 2:26585091-26585113 CACCCCTCAAGGTGGCTCTGTGG - Intronic
927890327 2:26744013-26744035 CAGCCCTCCAGCAGGGGCTGGGG - Intergenic
928172549 2:29012710-29012732 CTGCCCTCCAGCTGGCAACTGGG + Intronic
928987187 2:37193130-37193152 CTCCCATGCAGCTGCCTCTGGGG - Intronic
929114245 2:38431021-38431043 CTGCCTTAGAGCTGGGTCTGGGG + Intergenic
929405564 2:41637449-41637471 CTTTCCTCCTGCTAGCTCTGAGG + Intergenic
929783414 2:44972409-44972431 CTGCACTCCAGCCTGGTCTGGGG + Intergenic
930552430 2:52852442-52852464 CTGTCCTCCTGTTAGCTCTGAGG - Intergenic
931714397 2:65017583-65017605 GCTCCCTCTAGCTGGCTCTGCGG - Intronic
931906559 2:66849402-66849424 CTGCCCCAGAGCTGGCACTGCGG - Intergenic
932321835 2:70828241-70828263 CTGCCCTTCTGCTGGCAGTGTGG - Intergenic
932418178 2:71586270-71586292 CTTCCCTCAGCCTGGCTCTGGGG + Intronic
932490390 2:72116291-72116313 CTGGCCTGCAGGTGGCCCTGGGG - Intergenic
933574566 2:84052954-84052976 CTTCCCTCCAGCTGGCTACAAGG + Intergenic
933777838 2:85781957-85781979 GGGCCCCCCAGCTGACTCTGGGG + Intronic
933808395 2:86016773-86016795 TCTCCCTTCAGCTGGCTCTGGGG + Intergenic
933885856 2:86719410-86719432 CTGCCCGGCACATGGCTCTGGGG + Intronic
933924324 2:87077295-87077317 CTGCCCGGCACATGGCTCTGGGG - Intergenic
934735162 2:96686303-96686325 CTGCACTCCGGCAGGCTCTGTGG + Intergenic
934736706 2:96693346-96693368 GTGCTCTGCAGCTGACTCTGAGG + Intergenic
934775523 2:96934787-96934809 CTACCCTGCAGCCAGCTCTGAGG + Intronic
935936706 2:108193080-108193102 CTGCACTCCAGCTGGGGCAGCGG + Intergenic
937095393 2:119232214-119232236 CTGCATTCAAGCTGCCTCTGGGG - Intronic
937929299 2:127192164-127192186 CTGCCCTGCACCTGCCACTGTGG + Intronic
938141470 2:128798165-128798187 CTGCCCTCGAGCGTGCTGTGGGG - Intergenic
938291081 2:130150846-130150868 CTGAGCACCAGCTGGCTTTGTGG + Intergenic
938465070 2:131519936-131519958 CTGCCCTCCTGCCCACTCTGTGG - Intergenic
938780167 2:134577503-134577525 CAGGGCTCCAGCTTGCTCTGCGG - Intronic
941067400 2:160919061-160919083 CTGCCGGCCAGCGGGCTCAGAGG - Intergenic
941163981 2:162065653-162065675 CAGCCCCCAAACTGGCTCTGAGG - Intronic
942324105 2:174760957-174760979 CTGCCCTCCTGCTTCATCTGTGG - Intronic
942856552 2:180555881-180555903 TTTCCCCCCTGCTGGCTCTGAGG + Intergenic
943250701 2:185518504-185518526 CTTTCCTCCTGCTAGCTCTGAGG - Intergenic
945750806 2:213780142-213780164 CTGCTCTTCAGCCAGCTCTGGGG + Intronic
947201226 2:227616373-227616395 ATGACCTCAAGCTGTCTCTGTGG + Intronic
947637981 2:231689726-231689748 CCGCCCCCCTGCTGGCTCTGAGG + Intergenic
947715064 2:232335195-232335217 CTTGGCTCCAGCTGGCCCTGGGG + Intronic
947734139 2:232446146-232446168 CTTGGCTCCAGCTGGCCCTGGGG + Intergenic
948584979 2:239013585-239013607 CTGGCCTCCAGCTAGCACAGGGG - Intergenic
948643818 2:239391521-239391543 CTCCTCCCCCGCTGGCTCTGAGG - Intronic
1168802139 20:650438-650460 CTACTCTCCACCTGGCTGTGTGG - Intronic
1170554603 20:17505277-17505299 AAGCCCTCCACGTGGCTCTGCGG - Intronic
1170736220 20:19016066-19016088 CTGGCCACCTGCTGGCTCTTTGG + Intergenic
1171343120 20:24445912-24445934 CTGCCCTCCAGAAGACTTTGTGG + Intergenic
1171382655 20:24745298-24745320 ACGCCCTCCAGCAGACTCTGTGG + Intergenic
1171453849 20:25255453-25255475 CTGGCCTCTGGCTGGCTCAGTGG + Intronic
1172486900 20:35303894-35303916 CGGCCCGCCAGCTGGCTTCGAGG - Exonic
1172510556 20:35497972-35497994 CTGCCCTGCAGCAGGCCCTGGGG + Exonic
1172773944 20:37396609-37396631 CTCCCTTCCAGCTTACTCTGGGG - Intronic
1173269349 20:41517801-41517823 CTGCCCTGCTGCTGACTTTGGGG - Intronic
1173904888 20:46619264-46619286 ATGTCCTCCAGCTGGATTTGGGG + Intronic
1173947499 20:46963320-46963342 CTGCTCTACAGCAGGCCCTGTGG - Intronic
1173979110 20:47209091-47209113 GTGCCCACCACCTGGCTGTGGGG + Intergenic
1174656166 20:52174105-52174127 CTCCCCTTCACCTGGTTCTGTGG - Intronic
1175167082 20:57051983-57052005 CTGCCTTCCAGTTGACACTGGGG - Intergenic
1175327143 20:58137731-58137753 CTGCCCTCCACCTGGCAGAGAGG - Intergenic
1175532768 20:59685336-59685358 CTGCCAGCCACCTGGCTATGTGG - Intronic
1175878066 20:62239652-62239674 CTTCCCACCAGCTGGATGTGTGG + Intronic
1175974471 20:62703515-62703537 CTGCCTTCCACCTGGCTCTGCGG - Intergenic
1176207136 20:63895281-63895303 CCGCCCTCCCGCCGGCTCCGCGG - Exonic
1176428310 21:6561971-6561993 CAGCCCCTCAGCTGGCCCTGAGG + Intergenic
1178436948 21:32567946-32567968 CTGGCCTCCAGCGGTGTCTGAGG - Intergenic
1179703800 21:43170287-43170309 CAGCCCCTCAGCTGGCCCTGAGG + Intronic
1179906681 21:44426431-44426453 CTGCCCTTCAGCTGGCCCCAGGG + Intronic
1180139159 21:45880809-45880831 CTGCCCTCCCGCTGGCTCCCTGG - Intronic
1180175065 21:46083309-46083331 CTGCCCTCCCCCAGGGTCTGAGG - Intergenic
1180736876 22:18023999-18024021 CTGCTCTCTGGCAGGCTCTGGGG + Intronic
1181522509 22:23457719-23457741 CTGCCCTCCAGGTGGGGGTGGGG - Intergenic
1181588249 22:23866311-23866333 GTGCCCACCAGCTGCCTCTCGGG - Intronic
1181980028 22:26759752-26759774 CTGCCTCCAAGGTGGCTCTGAGG + Intergenic
1182148470 22:28012070-28012092 CTTCCCTCCTGCTCGCCCTGAGG - Intronic
1183075000 22:35421310-35421332 ATGGCCTCCAGCTGCCTGTGGGG - Exonic
1183198916 22:36372656-36372678 CTCCCCTCCAGCCTGCTCTTGGG - Intronic
1183382120 22:37495530-37495552 CTGCCCTCCAGCCGGCACCGAGG - Exonic
1184636180 22:45833804-45833826 CTGCCCTCCAGAGGTCTCTCTGG + Intronic
1184668724 22:46001899-46001921 CTGCCCTCGTGCTGGCTCAGTGG + Intergenic
1184811119 22:46832858-46832880 CTGGCTTCCACTTGGCTCTGTGG + Intronic
1184858722 22:47161063-47161085 CTGCCTCCCAGCTGGCCCTGGGG + Intronic
1184973377 22:48043489-48043511 TGGCCCTCCAGCTGGAACTGTGG + Intergenic
1185316678 22:50182341-50182363 CTGCTCGCCAGCTGGGGCTGGGG + Intergenic
1185382959 22:50518548-50518570 CTGCCCTCCTGCTGGCCCCTTGG + Intronic
949398882 3:3644953-3644975 CTCCCCTTTAGCCGGCTCTGTGG - Intergenic
949760382 3:7464047-7464069 AAGCCCTCCAGATGGCTCTGAGG - Intronic
950480445 3:13240424-13240446 CTGCCCTCCACCTAGCCCTGGGG - Intergenic
950621576 3:14210008-14210030 CTGCTCACCAGCAGGCTCCGTGG - Intergenic
952903708 3:38126289-38126311 CTGCCATCCTGCTGGCCCGGAGG - Exonic
953019639 3:39105257-39105279 CTGCCATCCAGCTCCCTCAGGGG + Intronic
953269276 3:41424332-41424354 CTTTCCTCCTGCTGGCTCTGAGG + Intronic
953571167 3:44072985-44073007 CTGCCCTGCAGCTTGCTGTTGGG + Intergenic
953706471 3:45234781-45234803 CTGCCCTGCAGCTGGGCCTGTGG + Intergenic
953958743 3:47250956-47250978 CTGGCATCCTGATGGCTCTGTGG + Intronic
954123765 3:48516804-48516826 CTGCCCTGGAGCTGGCTTTCCGG - Intergenic
959258747 3:104048495-104048517 CTTTCCTCCTGCTAGCTCTGAGG + Intergenic
960605693 3:119502593-119502615 CTGCACTCCAGCCTGCACTGAGG - Intronic
961388195 3:126536288-126536310 CTGGGCTCCAGCTGGCTTGGTGG + Exonic
961454172 3:127016096-127016118 CTGCCCTCCCTCTGTCCCTGGGG - Intronic
961781308 3:129322014-129322036 GCGCCCTGCAGCTGGCTCGGTGG - Intergenic
962395184 3:135009255-135009277 CTGTCCTCCTCATGGCTCTGGGG - Intronic
964041777 3:152269304-152269326 CTTCCCTGCCGCGGGCTCTGCGG + Intronic
964791031 3:160453223-160453245 CTGCTCTCCAGGTGGCTCCGGGG - Intronic
965199967 3:165645468-165645490 CTGCTCTCTCGCTTGCTCTGAGG + Intergenic
965342895 3:167512018-167512040 CTTTCCTTCTGCTGGCTCTGAGG + Intronic
966683841 3:182672243-182672265 CTGTTCTCCAGGTGGCTCTTTGG - Intergenic
966846957 3:184138160-184138182 CTGCCCTGAAACAGGCTCTGTGG - Exonic
967221046 3:187248395-187248417 CTGCCCTCAAGATTGCTGTGGGG - Intronic
968365554 3:198182576-198182598 CTGGCCTGCATCTGGCCCTGAGG + Intergenic
971015600 4:22485873-22485895 CTGCTCTCAGTCTGGCTCTGAGG - Intronic
971906478 4:32732608-32732630 CTTTCCTCCTGCTAGCTCTGAGG + Intergenic
972153769 4:36130270-36130292 CTGCCCTCCTGCTGCCTATGCGG + Intronic
972671343 4:41215919-41215941 CTGGCCTCCAGCTCGGTCTGAGG - Intronic
976505592 4:85842763-85842785 CTGCCAGCCAGCTGGCACTAGGG + Intronic
976856018 4:89606674-89606696 CTGCCTTTCTGCTGACTCTGTGG + Intergenic
977508972 4:97937968-97937990 CTTCCTTCCTGCTAGCTCTGAGG - Intronic
981273865 4:142875149-142875171 CTTTCCCCCTGCTGGCTCTGAGG + Intergenic
982372322 4:154647424-154647446 CTTTCTTCCTGCTGGCTCTGAGG + Intronic
982395596 4:154911929-154911951 CTGTTCTGCAGCTGGCTCTGTGG + Intergenic
983510551 4:168605480-168605502 CTGCCATACAGCTGGCTGTTTGG + Intronic
984701639 4:182822279-182822301 CTGCCGCCCAGCTGGGGCTGAGG + Intergenic
984723371 4:182997898-182997920 CTTTCCCCCAGCTAGCTCTGAGG + Intergenic
985652473 5:1113313-1113335 CTCCCCTCCAGCTGCCTTTTAGG - Intergenic
985834569 5:2261104-2261126 CTGCTCTCCGGGTGGCTCTGTGG + Intergenic
985865120 5:2508661-2508683 CTGCCGTCCAGCAGTCACTGAGG - Intergenic
988508749 5:31847565-31847587 CTGGCCTGCTGCTGGCTCGGAGG + Intronic
990075480 5:51841850-51841872 CTGCACTCCAGCCTGCGCTGAGG - Intergenic
991100583 5:62788163-62788185 CTGGCTTCCAGCTGGCCCAGTGG + Intergenic
991435773 5:66596286-66596308 CTGCCCTGCCATTGGCTCTGCGG + Intergenic
992753995 5:79887160-79887182 CTGACTTCCTGTTGGCTCTGAGG + Intergenic
994350721 5:98742864-98742886 CTTTCCCCCTGCTGGCTCTGAGG + Intergenic
996527239 5:124492121-124492143 CTTTCCTCCAGCTAGTTCTGAGG - Intergenic
998046310 5:138989895-138989917 CTGACTGCCAGCTGGCTCTGTGG + Intronic
1000042157 5:157492929-157492951 CTGCTCTGCAGCTGGCTCCTAGG + Intronic
1000719914 5:164693502-164693524 TTTCCCACCTGCTGGCTCTGAGG + Intergenic
1001319253 5:170666864-170666886 GTGTCCTCCAGCAGACTCTGAGG + Intronic
1002279921 5:178124077-178124099 CTGGCCAGCACCTGGCTCTGAGG - Exonic
1002521229 5:179794200-179794222 CTGCCCTCCACCTGGGCCTAGGG - Intronic
1002846249 6:947752-947774 CTGACCCCTAGGTGGCTCTGGGG + Intergenic
1003427258 6:6006145-6006167 TTGCCCACCAGCCGGGTCTGCGG + Intronic
1003989171 6:11468963-11468985 AAGCCCTCCAGGTGGCTCTGAGG - Intergenic
1004520663 6:16358586-16358608 CTGCCATCAAGCTGGCTGCGCGG + Intronic
1005021442 6:21423210-21423232 CTGCCCTCCGGCTGCTTCTTCGG + Intergenic
1005968354 6:30742791-30742813 CCGCCCGCCCGCTGGCTCTCGGG + Intergenic
1006300529 6:33191612-33191634 CTGCCACGCAGCTGGCTCTGGGG - Intronic
1006789033 6:36686645-36686667 CTCAGCTCCAGGTGGCTCTGAGG + Exonic
1006946445 6:37787623-37787645 CTGCCCTCTAGCCAGCCCTGAGG - Intergenic
1007924554 6:45640900-45640922 CTGCCCTCCACCTTGCTCCTGGG - Intronic
1008107581 6:47456028-47456050 GAGCCCTCCAGGTGGTTCTGAGG - Intergenic
1008941205 6:57047324-57047346 TGTCCCTCCAGCTGGCCCTGAGG + Exonic
1008945394 6:57090822-57090844 TGTCCCTCCAGCTGGCCCTGAGG + Exonic
1010204409 6:73309780-73309802 CTTCCCGCCGGCGGGCTCTGCGG - Exonic
1012315085 6:97775372-97775394 CTTTCCTCCTGCTGGCTCTGAGG + Intergenic
1013098100 6:106964238-106964260 ATGGCCTCCAGCTGTATCTGAGG + Intergenic
1014064707 6:117111107-117111129 CTTTCCTCCTGCTAGCTCTGAGG + Intergenic
1014422339 6:121261197-121261219 CTTTCCTCCTGCTAGCTCTGAGG + Intronic
1015225638 6:130853866-130853888 CAGCCCACCTGCTGCCTCTGTGG + Intronic
1015486120 6:133771907-133771929 ATTCCCTCCAGCTGGGTTTGAGG + Intergenic
1016199878 6:141394536-141394558 CCCGCCTCCCGCTGGCTCTGTGG - Intergenic
1016680233 6:146820650-146820672 CTCCCCTGTTGCTGGCTCTGGGG + Intergenic
1017022650 6:150152679-150152701 CTGCTGTCAGGCTGGCTCTGTGG + Intronic
1017565899 6:155686291-155686313 CTCCCCTAGAGCTGTCTCTGTGG - Intergenic
1017649723 6:156569926-156569948 GAGCCCTCCAGCTGATTCTGAGG - Intergenic
1017706725 6:157130758-157130780 TTACCCTCCAGCTGCCTCAGTGG + Intronic
1017875936 6:158524317-158524339 CTACCCTTCCGCAGGCTCTGAGG + Intergenic
1017958943 6:159205005-159205027 CTGCCCTCCTGCTGGCTCTAGGG + Intronic
1018399215 6:163405483-163405505 CTGCTCTGCAGCTGCCTCGGAGG + Intergenic
1018697631 6:166402751-166402773 CTGCCATCCAGCCTGCCCTGAGG + Intergenic
1019037813 6:169076466-169076488 GTGCTTTCCAGCAGGCTCTGAGG + Intergenic
1019221986 6:170480209-170480231 CTGCCCTCTAGGAGGCTTTGGGG - Intergenic
1019392351 7:795348-795370 CACCCCTCAGGCTGGCTCTGTGG - Intergenic
1019568751 7:1697969-1697991 CCGCCCGCCGGCCGGCTCTGCGG - Intronic
1019588824 7:1818848-1818870 CTGCCCTCCAGGTGGGGGTGGGG + Intronic
1019667483 7:2259104-2259126 CTGGGCTCCAGCTGCCACTGAGG + Intronic
1020430680 7:8113544-8113566 CTAGCCTCCTGCTGCCTCTGAGG + Exonic
1021776546 7:24059977-24059999 CTTTCCCCCTGCTGGCTCTGAGG + Intergenic
1022007561 7:26280154-26280176 TTTCATTCCAGCTGGCTCTGAGG - Intergenic
1022140951 7:27492433-27492455 CTGGACTCCAGCTGTCTTTGAGG + Intergenic
1023851351 7:44152122-44152144 CAGGCCTCCAGCTGCCTCTGAGG + Intronic
1023879120 7:44308585-44308607 CTGCCCTCCGGGTGTCCCTGTGG - Intronic
1024859667 7:53823824-53823846 CTTTCATCCTGCTGGCTCTGAGG + Intergenic
1026385719 7:69845734-69845756 CTCACCTCCAGCTTGCTCTAGGG - Intronic
1027513725 7:79115039-79115061 CTGCCCTCCTCCTGGCTTTCAGG - Intronic
1028527025 7:91797872-91797894 CTGCATTCCAGCTGTCTCAGTGG - Intronic
1028644184 7:93076921-93076943 CTTTCCTCCTGCTAGCTCTGAGG + Intergenic
1029417191 7:100450615-100450637 CTGACCTCCAGGTGGCGCCGCGG - Intergenic
1030005419 7:105113189-105113211 CTGTCCTCATCCTGGCTCTGTGG + Exonic
1030688805 7:112511960-112511982 CTGCTCTGCGGCTGGCTCTGGGG + Intergenic
1032091866 7:128915258-128915280 CACCCCTCCCGCTGGCTCCGCGG + Intergenic
1032745238 7:134779655-134779677 CTGCCCGCCTGCTTGCTCTCTGG + Exonic
1032790070 7:135236063-135236085 CTGCCCTCCAGCTTGGTCAATGG + Intronic
1032823109 7:135542984-135543006 CTGCCCTCCTGCTAGCTCCTGGG - Intergenic
1034337063 7:150330535-150330557 CAGCCATCCAGCTGGCTGAGGGG + Exonic
1035004469 7:155644823-155644845 CGGCCCACCAGCTGGCTTGGTGG + Exonic
1035132953 7:156672925-156672947 CAGCCCTCCAGGTGATTCTGAGG - Intronic
1035241248 7:157530993-157531015 CTGACCTCCAGCTCCCTCTTTGG + Intergenic
1035260544 7:157659116-157659138 TTTCCCTCCACCTGGCTCTCTGG + Intronic
1035302428 7:157906276-157906298 CTGCACTCCCAGTGGCTCTGTGG - Intronic
1035437372 7:158869151-158869173 CTGCCCTGGTGCTGGCTGTGAGG + Intronic
1035564876 8:634934-634956 CTGCCCTCTTGGTGCCTCTGGGG + Intronic
1035567585 8:651617-651639 CTGCCCACCAGCTCTCTCTCTGG - Intronic
1035670655 8:1414612-1414634 CTGCCCGGCAGCTGTCTCTGAGG + Intergenic
1035706216 8:1677354-1677376 CTGCCTTCCATCCTGCTCTGTGG + Intronic
1036173715 8:6515500-6515522 CTGCTCTTAAACTGGCTCTGTGG + Intronic
1036708278 8:11060774-11060796 CTGCCCTGCACTGGGCTCTGTGG + Intronic
1036757707 8:11482256-11482278 TTCCCCTGCAGGTGGCTCTGGGG + Intergenic
1036830456 8:12016035-12016057 CAGGCCTCCAGCTGGGGCTGAGG + Intergenic
1037694342 8:21210168-21210190 CTGCCATCCGGCTGGCTTTCAGG - Intergenic
1037814538 8:22104951-22104973 CTGCCCTCCCGCAGTCTCTTGGG - Intergenic
1037881425 8:22575204-22575226 CTGGCCTCCAGCTGGGTGTGGGG + Exonic
1039183889 8:34895303-34895325 CTGCCCGGCCGCTGCCTCTGGGG + Intergenic
1040752857 8:50731626-50731648 ATGCCTTATAGCTGGCTCTGAGG - Intronic
1041021352 8:53642303-53642325 CTTTCCTCCTGCTAGCTCTGAGG - Intergenic
1041704795 8:60835130-60835152 CTGACCTCCTCCTGCCTCTGGGG - Intronic
1043610047 8:82051463-82051485 CTGCCCACCAGGTCGCTCTCTGG + Intergenic
1044137682 8:88608361-88608383 CTGCCCTGCAGATGGCTGTGGGG + Intergenic
1045052096 8:98336670-98336692 CTGCCCTCCACGTGTCTCAGAGG - Intergenic
1046282658 8:112053875-112053897 CTACCCTCAAGTAGGCTCTGGGG + Intergenic
1046657676 8:116912950-116912972 CTTTCCCCCTGCTGGCTCTGAGG - Intergenic
1046708874 8:117487217-117487239 CTTTCCTCCTGCTAGCTCTGAGG + Intergenic
1047446141 8:124921466-124921488 CAGCCCTCCGGCTGGCACGGGGG - Intergenic
1047740180 8:127800399-127800421 CTGTCCCCCAGCTGTCTCTGGGG - Intergenic
1048195392 8:132328009-132328031 ATGCCCCCATGCTGGCTCTGGGG - Intronic
1048206292 8:132417910-132417932 CTGCCCTCTGGCTGGCTCATGGG - Intronic
1048476002 8:134742862-134742884 CTCCCCTCCAGCAAGCTCTAAGG + Intergenic
1049172540 8:141170703-141170725 CTGCCCCCCAGGTGGCTCCTGGG - Intronic
1049308762 8:141922295-141922317 CTGCCTTCCAGCAGGCCCTCAGG - Intergenic
1049392402 8:142378953-142378975 CTTCCCACCAGCAGGCTCTGTGG + Intronic
1049448123 8:142641040-142641062 CTGCCCTGCAGATGGCTGTAAGG + Intergenic
1049625397 8:143617536-143617558 CCGCCCCCCACCTGGCTCCGCGG - Exonic
1049794749 8:144492036-144492058 CTGCCCTCCAGCTGGCTCTGGGG - Intronic
1049794765 8:144492083-144492105 CTGCCCTCCGGCTGGTTCTGGGG - Intronic
1050209710 9:3239793-3239815 GTCACATCCAGCTGGCTCTGTGG - Intronic
1052115703 9:24646414-24646436 CTTTCCTCCTGCTAGCTCTGAGG - Intergenic
1053286053 9:36850171-36850193 CTGCCCTGCAGCTGCCTCTGCGG - Intronic
1053447548 9:38164621-38164643 CTGCCCTCCTCCTGCCTCTATGG + Intergenic
1053610659 9:39709987-39710009 CTCCCCTCCAGGGGGTTCTGGGG - Intergenic
1053868694 9:42468009-42468031 CTCCCCTCCAGGGGGTTCTGGGG - Intergenic
1054087594 9:60761170-60761192 CTCCCCTCCAGGGGGTTCTGGGG + Intergenic
1054242863 9:62632408-62632430 CTCCCCTCCAGGGGGTTCTGGGG + Intergenic
1054556988 9:66666926-66666948 CTCCCCTCCAGGGGGTTCTGGGG + Intergenic
1054832545 9:69642886-69642908 CAGCCTTCCAGCTTGCTCTGTGG + Intronic
1054835612 9:69672401-69672423 CCGCCCTCCAGCTAGCTCGCTGG + Intergenic
1057261619 9:93587697-93587719 CCACCCTCCAACTGGCACTGGGG - Intronic
1057270887 9:93650755-93650777 CTGCCCTCCAGCTGGCCCCTGGG + Intronic
1057299566 9:93870065-93870087 CTCCCCAGCAGCTGGCTCTCAGG - Intergenic
1057543017 9:95993448-95993470 CTGCTGACCTGCTGGCTCTGTGG - Intronic
1057550684 9:96049367-96049389 CTGGGCTCCGGCTGGCTCAGGGG - Intergenic
1057800925 9:98191341-98191363 CTGCCCTGGAGCAGGCTGTGGGG - Intronic
1058091477 9:100810930-100810952 CTGCTCTCCTGCTCTCTCTGTGG - Intergenic
1058530323 9:105900001-105900023 CTTTCCCCCTGCTGGCTCTGAGG - Intergenic
1059312667 9:113399454-113399476 CTGCCTTCCAGCAGGTTATGTGG + Intronic
1059411855 9:114137579-114137601 CTGACCACCCGCTGGCACTGGGG - Intergenic
1059433062 9:114261250-114261272 CTGCCCTCCAGCCAGGCCTGGGG - Intronic
1059451626 9:114374493-114374515 CTGCCCACCGGTTGGCTCTGTGG + Intronic
1060804308 9:126564911-126564933 ATGGCCTGCAGGTGGCTCTGGGG + Intergenic
1061161654 9:128898966-128898988 CTGGCCTCCAGCTGGCAGAGAGG - Intronic
1061822992 9:133238851-133238873 GAGCCCTCCAGTGGGCTCTGAGG + Intergenic
1061877221 9:133550310-133550332 CTGCCTTTCAGCTGGCACTGTGG + Intronic
1061990538 9:134156338-134156360 CTGCCCTCCAGCCAGGCCTGAGG - Intronic
1062017993 9:134301372-134301394 CTGACCTCCATGTGGCTCTGTGG + Intergenic
1062053664 9:134459738-134459760 CCTCCCTCCTGCTGGCTCTGTGG + Intergenic
1062113706 9:134796518-134796540 CTACCCTTCAGCAGGGTCTGAGG - Intronic
1062167106 9:135113355-135113377 ATGAGCTCCAGCAGGCTCTGAGG + Intronic
1062174332 9:135152670-135152692 CTGCTCTCCATCTGGGTATGGGG + Intergenic
1062260177 9:135658252-135658274 CTTCCCTCCAGATAGCTCTGTGG - Intergenic
1062552949 9:137098501-137098523 ATGCCCCCCAGGTGTCTCTGAGG + Intronic
1062709957 9:137969875-137969897 CTGCCCTACTGCTGCCTCTGTGG + Intronic
1186600376 X:11030380-11030402 CTGCTCTCAATCTGGCTTTGGGG - Intergenic
1187942300 X:24393766-24393788 CTCCTCTCCAGCTTCCTCTGTGG - Intergenic
1188686552 X:33076834-33076856 CTCCCGCACAGCTGGCTCTGAGG - Intronic
1189757109 X:44283023-44283045 CTGTCCTCCAGCTGGCCGTTGGG + Intronic
1189795207 X:44639447-44639469 CTGCCCTCCAGTTTCCCCTGTGG + Intergenic
1190486558 X:50931600-50931622 CTGCCCTGGAGCTGTCTCTATGG + Intergenic
1190635019 X:52424904-52424926 CTGCCCTCCTTCTGCCTATGAGG + Intergenic
1190641361 X:52484218-52484240 CTCCCCTCCAGCAGCCTCTGAGG - Intergenic
1190646311 X:52528647-52528669 CTCCCCTCCAGCAGCCTCTGAGG + Intergenic
1190649679 X:52556784-52556806 CTGCCCTCCATCTGCCTGTGAGG - Intergenic
1190683860 X:52852991-52853013 CTGCCCTCCTTCTGTCTGTGAGG - Intergenic
1192360273 X:70434679-70434701 CTGACCTGCAGCTGGCGCGGTGG + Intergenic
1192493788 X:71599410-71599432 CTGCCCTCAAGCTGCCTCCTTGG - Intronic
1192845454 X:74902675-74902697 CTGCCATCCTCCTGGGTCTGAGG + Intronic
1192910058 X:75593811-75593833 TTGTCCTCCAGATGTCTCTGTGG - Intergenic
1193034528 X:76934817-76934839 ATTCCTGCCAGCTGGCTCTGAGG + Intergenic
1194183141 X:90737816-90737838 CTTTCCTCCTGCTGGCTCTGAGG + Intergenic
1194577787 X:95635728-95635750 CTGCCATAGAGCTGTCTCTGTGG - Intergenic
1195004415 X:100671884-100671906 GGGCCCTCCAGCTGGCTCACGGG + Intergenic
1195376673 X:104234539-104234561 CTGCCCTCAACCTATCTCTGAGG - Intergenic
1195735604 X:108009645-108009667 CTACCCTTCATCTTGCTCTGAGG + Intergenic
1195812697 X:108851748-108851770 CTTTCCCCCTGCTGGCTCTGAGG + Intergenic
1196229274 X:113202708-113202730 CTTTCCTCCTGCTGGCTCTGAGG - Intergenic
1196627316 X:117891188-117891210 CTGCCCTAGAGCTGTGTCTGTGG - Intergenic
1197607059 X:128597245-128597267 CTTTCCTCCTGCTAGCTCTGAGG - Intergenic
1199308199 X:146292463-146292485 CTTTCCCCCTGCTGGCTCTGAGG - Intergenic
1200529753 Y:4319771-4319793 CTTTCCTCCTGCTGGCTCTGAGG + Intergenic
1201304961 Y:12542233-12542255 CTGCCCTCCTGGCTGCTCTGTGG - Intergenic