ID: 1049794750

View in Genome Browser
Species Human (GRCh38)
Location 8:144492037-144492059
Sequence CCTGCCCTCCAGCTGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 1, 2: 1, 3: 63, 4: 450}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049794750_1049794769 27 Left 1049794750 8:144492037-144492059 CCCAGAGCCAGCTGGAGGGCAGG 0: 1
1: 1
2: 1
3: 63
4: 450
Right 1049794769 8:144492087-144492109 AGAACCAGCCGGAGGGCAGGTGG No data
1049794750_1049794759 -5 Left 1049794750 8:144492037-144492059 CCCAGAGCCAGCTGGAGGGCAGG 0: 1
1: 1
2: 1
3: 63
4: 450
Right 1049794759 8:144492055-144492077 GCAGGCAATGTGGGGGCGCTGGG No data
1049794750_1049794758 -6 Left 1049794750 8:144492037-144492059 CCCAGAGCCAGCTGGAGGGCAGG 0: 1
1: 1
2: 1
3: 63
4: 450
Right 1049794758 8:144492054-144492076 GGCAGGCAATGTGGGGGCGCTGG No data
1049794750_1049794761 16 Left 1049794750 8:144492037-144492059 CCCAGAGCCAGCTGGAGGGCAGG 0: 1
1: 1
2: 1
3: 63
4: 450
Right 1049794761 8:144492076-144492098 GGCTGGCCCCCAGAACCAGCCGG No data
1049794750_1049794760 -1 Left 1049794750 8:144492037-144492059 CCCAGAGCCAGCTGGAGGGCAGG 0: 1
1: 1
2: 1
3: 63
4: 450
Right 1049794760 8:144492059-144492081 GCAATGTGGGGGCGCTGGGCTGG No data
1049794750_1049794767 24 Left 1049794750 8:144492037-144492059 CCCAGAGCCAGCTGGAGGGCAGG 0: 1
1: 1
2: 1
3: 63
4: 450
Right 1049794767 8:144492084-144492106 CCCAGAACCAGCCGGAGGGCAGG No data
1049794750_1049794763 20 Left 1049794750 8:144492037-144492059 CCCAGAGCCAGCTGGAGGGCAGG 0: 1
1: 1
2: 1
3: 63
4: 450
Right 1049794763 8:144492080-144492102 GGCCCCCAGAACCAGCCGGAGGG No data
1049794750_1049794762 19 Left 1049794750 8:144492037-144492059 CCCAGAGCCAGCTGGAGGGCAGG 0: 1
1: 1
2: 1
3: 63
4: 450
Right 1049794762 8:144492079-144492101 TGGCCCCCAGAACCAGCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049794750 Original CRISPR CCTGCCCTCCAGCTGGCTCT GGG (reversed) Intronic
900082657 1:870036-870058 CCTGCCCTCCAGCGGGGCCGCGG + Intergenic
900091416 1:922378-922400 CATGGCCTCCAGCTGGCCCCAGG + Intergenic
900092835 1:927881-927903 CCTGCCCTCCAGGTGCCTTGGGG + Intronic
900195484 1:1373597-1373619 CCCTCTCTCTAGCTGGCTCTTGG - Intergenic
900308159 1:2020987-2021009 CCTGGCCTGCATCTGGCTCCTGG + Intronic
900512318 1:3066562-3066584 CTTGCCCTCCACCAGGCTGTTGG - Intergenic
900537818 1:3187460-3187482 CCTGCTCTCCTGGTGGCTCGTGG + Intronic
900725779 1:4215673-4215695 CCTGCCCACTAGCTGGTTTTGGG + Intergenic
901025544 1:6277033-6277055 ACTGCTCCCCAGCTGGCTCTGGG + Intronic
901091576 1:6645190-6645212 TCTGCCCTCCCACTAGCTCTGGG + Intronic
901167194 1:7229346-7229368 CCTGGCCTCCAGCTGCCTCGTGG - Intronic
901770582 1:11528511-11528533 CCTGCCCTCGAGCTGTCTAGTGG + Intronic
902245995 1:15120752-15120774 CATCCCCTCCAGCTGCCTCTCGG + Intergenic
902289035 1:15424787-15424809 CATGCCCCCCAGCTTGCCCTAGG - Intronic
902332176 1:15736065-15736087 CCTGGCCTCCCTCTGGCCCTGGG - Intergenic
902443031 1:16443703-16443725 CCTGTCCTCCAGCTTGATGTAGG - Exonic
902836935 1:19053537-19053559 CCAGCCCTCCTGCCGGCTCCTGG + Intergenic
902957538 1:19935822-19935844 CCTGCCCTCCAGATGCTTCCAGG - Intergenic
903062930 1:20682938-20682960 CGTGCCATCCAGCAGGCTCCAGG + Intronic
904093589 1:27961141-27961163 TCTGCCCTCTTGCTGGGTCTGGG - Intronic
904212245 1:28893652-28893674 CCTGCCCTCCCTCTGCCTCTGGG - Intronic
904355261 1:29934489-29934511 CCTGCCCACAGGCTGTCTCTGGG - Intergenic
904401515 1:30259806-30259828 CCTGCCCTCCAGGTCGCCCTGGG + Intergenic
904852364 1:33468592-33468614 ACTGCCCTCCAGCTGGCCGGGGG + Intergenic
905242534 1:36590088-36590110 TCTGACCTCAAGCTGGCTGTGGG + Intergenic
905243663 1:36597380-36597402 CCTCCCCTCCACTTGTCTCTTGG + Intergenic
905472970 1:38207149-38207171 CCCTCCCTCCAGGTGCCTCTCGG - Intergenic
905730987 1:40299551-40299573 CCTGCACTCCAGGGGGCCCTTGG + Intergenic
906749868 1:48249241-48249263 CCTGCCTTCTGCCTGGCTCTTGG + Intergenic
907303418 1:53501801-53501823 CCTGTGCTCCTGCTGGCCCTTGG - Intergenic
909468824 1:76003446-76003468 TTTGCACTCCAGCAGGCTCTTGG - Intergenic
910219534 1:84876451-84876473 CCTCCCCTCCAGGTTGCTGTAGG + Intronic
911636159 1:100238288-100238310 CCCTCCCTCCTGATGGCTCTAGG + Intronic
913236225 1:116785508-116785530 CCTGCCCACCACCTGACCCTAGG + Intergenic
913546315 1:119872261-119872283 CCCGCCCTCCTGATGGGTCTAGG - Intergenic
915626379 1:157116428-157116450 CCTGGCATCCAGCAGGCACTCGG + Intergenic
916495641 1:165344474-165344496 CCTTCTCTAAAGCTGGCTCTTGG - Intronic
916851856 1:168712258-168712280 CCAGGCCTCCAGCTGCCCCTAGG + Intronic
918380843 1:183953550-183953572 CCTTCCCTACAGCTCTCTCTCGG - Intronic
919795254 1:201317797-201317819 ACAGCCCTCAGGCTGGCTCTCGG - Intronic
919843948 1:201629222-201629244 CCTGCCCTCCAGCAGGCAGCAGG - Intronic
920150868 1:203906282-203906304 CCTGGCCTCCTGCTGGTTCCTGG + Intergenic
920182929 1:204143608-204143630 CTTCCCCTCCTGCTGGCCCTGGG - Intronic
920672236 1:208013375-208013397 ACCCCCCTCCAGATGGCTCTCGG + Intergenic
920699274 1:208205379-208205401 CCTCCCCTACATCTGGCCCTAGG + Intronic
920712437 1:208308153-208308175 CCTGCCATCCAGGTTGCTTTAGG - Intergenic
921222359 1:212982105-212982127 CCCTCCGTCCAGCTGGCTCCGGG + Intronic
922128987 1:222758079-222758101 CTTTCCATCCAGCTGGCTGTGGG + Intergenic
922880979 1:228980400-228980422 CCAGACCTCCAGCTGGCTTGCGG - Intergenic
923109297 1:230878423-230878445 CCTGCCCTCCCTCTGTCTCCAGG - Intergenic
923686345 1:236156193-236156215 CCTGGCCTCGTGCTGGCCCTTGG - Intronic
923967349 1:239156428-239156450 CCTTCCTTCCACCTGGCTATGGG + Intergenic
1063866124 10:10367241-10367263 CCTGTCCTGCATCTGGCTCATGG + Intergenic
1063936297 10:11082094-11082116 CCTGCCCTCCACAGGACTCTGGG - Intronic
1064096036 10:12425156-12425178 CCTTCTCCCCAGCTGGCTCCTGG + Intronic
1065357439 10:24856229-24856251 ACTGCCCTCCAGCTTGGGCTGGG + Intronic
1065444358 10:25782309-25782331 CCTGCCCTCCAGCAGCTACTTGG + Intergenic
1066186973 10:33019427-33019449 CTTTCCCTCAGGCTGGCTCTGGG - Intergenic
1067551647 10:47240557-47240579 CCTTCCCTCCTGCTTGCCCTAGG - Intergenic
1067735309 10:48845944-48845966 CCAGCCCTGGACCTGGCTCTTGG - Intronic
1069631335 10:69898607-69898629 CCTGCCCTCCTGGTGACTTTTGG + Intronic
1070715056 10:78713844-78713866 CCTGCTCTCTACCTGGCACTGGG - Intergenic
1070724208 10:78777439-78777461 CCTGCCCCCCAGCTGGACCCTGG + Intergenic
1070797115 10:79223300-79223322 CCTGCCTGCCTGCTGTCTCTGGG - Intronic
1070908004 10:80091580-80091602 CCTTCCCTCCACCTGGCCCCTGG + Exonic
1071060927 10:81570465-81570487 GCTGCCCTGCAGGTTGCTCTTGG - Intergenic
1072719069 10:97769801-97769823 CCTGCACCCCAAGTGGCTCTTGG - Intronic
1072740844 10:97908189-97908211 CCTGTCCTCCAGGTGGGCCTGGG - Intronic
1074818056 10:117158482-117158504 CCTGCTCTCCAGCATGATCTGGG + Intergenic
1074938767 10:118214288-118214310 CCTGCCCAGCAGCCGGCCCTTGG - Intergenic
1075066281 10:119291126-119291148 CATACCCTGCGGCTGGCTCTGGG - Intronic
1075655715 10:124159810-124159832 CCTGCCCTCCCACTGGGGCTGGG - Intergenic
1075659318 10:124182396-124182418 CCTGCCCTGCTGCTGTCCCTGGG - Intergenic
1076068708 10:127469115-127469137 CCTGCCCTCCAGCTGTTTCCAGG + Intergenic
1076169519 10:128307857-128307879 CCTGCCCCCCAGTTTGCTCAAGG - Intergenic
1076246326 10:128950209-128950231 CCTGCCCTCCTGGTGCCTCCAGG - Intergenic
1076544853 10:131238424-131238446 GCAGCCCTGCAGCTGGCTCCTGG - Intronic
1076599208 10:131646155-131646177 CCTGCCCTCAGGCTGGGACTCGG + Intergenic
1076622936 10:131804296-131804318 CCTGCCCTGTGGCTGGCTGTGGG + Intergenic
1077052093 11:571529-571551 CCAGGCATCCACCTGGCTCTGGG + Intergenic
1077240316 11:1507300-1507322 CATGGCCTCCACCTGGCTCTTGG - Intergenic
1077294747 11:1820940-1820962 CCTTCCCTCCATGTGGCCCTGGG + Intergenic
1077373478 11:2194510-2194532 CCTGCCGCCCAGCTGGATCTGGG + Intergenic
1078355430 11:10628703-10628725 CCTGCCCTGCCTCTCGCTCTGGG - Intronic
1078638937 11:13077654-13077676 TCTTCCCTCCAAGTGGCTCTGGG + Intergenic
1079158748 11:17973533-17973555 CCTTCCCTACTGCTGCCTCTGGG - Intronic
1081808959 11:45904753-45904775 CCCGCCCTCCAGCTGTGTCCTGG + Exonic
1083863994 11:65443751-65443773 CCTGCGCCCCAGATGGTTCTAGG + Intergenic
1084733114 11:71087270-71087292 CCATCTCTCCAGCTGGCCCTGGG - Intronic
1085803288 11:79611493-79611515 CCTGTTCTCCCTCTGGCTCTTGG + Intergenic
1087050542 11:93882355-93882377 CCTCCCACACAGCTGGCTCTGGG + Intergenic
1087102886 11:94381874-94381896 CCTGCCCCACAGGAGGCTCTGGG - Intronic
1088562133 11:111125992-111126014 CCTTGCCTCCAACTGGCACTGGG + Intergenic
1089132447 11:116223279-116223301 CCTCCCCCTCACCTGGCTCTGGG + Intergenic
1089191424 11:116656257-116656279 CCAGCCCTCCAGCTGAGCCTGGG + Intergenic
1089751389 11:120653877-120653899 GCTGGGCTCCATCTGGCTCTGGG - Intronic
1089905113 11:122030515-122030537 CCAAACATCCAGCTGGCTCTGGG - Intergenic
1090028464 11:123187206-123187228 CCTGGCTTCCAGCAGGGTCTGGG + Intronic
1090077904 11:123590982-123591004 CCGGACCTCCAGCTGGCCCTGGG + Intronic
1090629302 11:128632584-128632606 GCTGTTCTGCAGCTGGCTCTGGG - Intergenic
1091930644 12:4392638-4392660 CCTGACCTCCAGCAGGCTGAGGG - Intergenic
1092230117 12:6771479-6771501 CCTGCCCTCCAACTCTCCCTGGG + Intergenic
1093027575 12:14258782-14258804 CCTGCCCCCCAGCTCGCACCAGG - Intergenic
1101269453 12:103128334-103128356 CCTGCCCTGCACCTGGCTCAGGG + Intergenic
1101425954 12:104588755-104588777 CCTGCTCACCAGCAGCCTCTGGG + Intronic
1101747401 12:107553575-107553597 CCTTCCTTCCAGCTTGGTCTGGG - Intronic
1101881460 12:108628806-108628828 CCTCCACCCCAGCTGTCTCTGGG - Intronic
1102163419 12:110787405-110787427 CCTGCCCTCCAACAGCCTTTGGG + Intergenic
1102168580 12:110824928-110824950 CGTGCCCACCAGCTTGCTTTGGG + Intergenic
1103209179 12:119154350-119154372 CCGGGCCTCCAGGTGGCTCGGGG - Exonic
1103339758 12:120215196-120215218 CATGCTGTCCAGCTGGCTCCCGG + Exonic
1103735653 12:123059220-123059242 ACTGCTCTCCAGATGGCCCTTGG - Intronic
1103848231 12:123914561-123914583 CCCTCCCTCCTGCTGGCTCAGGG - Intronic
1104378733 12:128288442-128288464 CCTCCCCTGCAGCTGGGTCTGGG + Intronic
1104637826 12:130449073-130449095 CCTGCCCTTCAGCTGGCATCGGG - Intronic
1104730721 12:131103934-131103956 CCTGCGCTCCAGGAGGCTCCGGG - Intronic
1105350054 13:19606831-19606853 CCTGCCCTTCAGCCGTCACTGGG + Intergenic
1105854537 13:24362220-24362242 CCTGACCTGAAGCTGCCTCTGGG + Intergenic
1107381064 13:39857024-39857046 CCTGACTTCCAGCTGACTGTGGG - Intergenic
1107734002 13:43376949-43376971 CATGCACTCCAGCTACCTCTTGG + Intronic
1109708824 13:66136860-66136882 CCTGCCTTCTTGCTGGCTGTTGG + Intergenic
1109971060 13:69769853-69769875 CCTGCCATTCAGCAGGTTCTGGG - Intronic
1110870756 13:80449892-80449914 CCTGCCCCACTGCTGACTCTAGG + Intergenic
1112119755 13:96396718-96396740 CCTGCACTACAGGTGGCCCTTGG + Intronic
1112693027 13:101917063-101917085 CCCGCCCTCCAGCCGGCGCCCGG - Intronic
1113565955 13:111320024-111320046 CCTGCCCTCCTGCGGCATCTCGG + Intronic
1114039886 14:18668027-18668049 CCTTCCCTCCACCTGGCCCTTGG + Intergenic
1114044928 14:18866576-18866598 CCTTCCCTCCACCTGGCCCCTGG + Intergenic
1114119294 14:19652946-19652968 CCTTCCCTCCACCTGGCCCCTGG - Intergenic
1117293212 14:54353624-54353646 CCTGCCCTCACGCTTCCTCTTGG + Intergenic
1117373767 14:55102322-55102344 CATGCCCTCCTGCAGGCCCTGGG - Intergenic
1118852600 14:69595582-69595604 TCTGCCCTCCCGCTGCCTCTGGG + Intergenic
1119264026 14:73253743-73253765 CCTGCCTTCCAGCTGGCAGGAGG - Exonic
1120368968 14:83607722-83607744 TCTTTCCTCCGGCTGGCTCTGGG - Intergenic
1121096661 14:91222124-91222146 CCTGCCCTCCAGCTGCTCCCTGG + Intronic
1121224326 14:92310133-92310155 CCTGGCTGCCATCTGGCTCTTGG + Intergenic
1121553736 14:94820826-94820848 CTTGCCCTCCAGCTTCCTGTGGG - Intergenic
1121622829 14:95362010-95362032 CCTGCCCTCCTGGAGGCACTGGG + Intergenic
1122031699 14:98917012-98917034 CCTGCCCCAGAGCTGGCCCTTGG - Intergenic
1122597293 14:102902451-102902473 CCTACCCTGCTGCTGGGTCTGGG - Intronic
1122817511 14:104320891-104320913 CCTCCTCTCCAGCTGGGTGTGGG - Intergenic
1122831394 14:104398859-104398881 ACTTCCCTCCACCTGACTCTAGG + Intergenic
1122838571 14:104443368-104443390 CCTGCTCTGCAGCTGCCACTGGG - Intergenic
1123472111 15:20562931-20562953 CCTTCCCTCCTGCTGCCTCAAGG + Intergenic
1123645892 15:22437422-22437444 CCTTCCCTCCTGCTGCCTCAAGG - Intergenic
1123667209 15:22617291-22617313 CCTCCCCTCCTGCTGCCTCAAGG - Intergenic
1123708439 15:22967621-22967643 TCTGCCCTCCACCTGGGCCTGGG + Intronic
1123732415 15:23157922-23157944 CCTTCCCTCCTGCTGCCTCAAGG + Intergenic
1123750550 15:23355304-23355326 CCTTCCCTCCTGCTGCCTCAAGG + Intronic
1123943100 15:25226045-25226067 CCTCCCCTCCACCAGGCTCCAGG - Intergenic
1124185651 15:27526161-27526183 CAAGCCCTCCACCTTGCTCTGGG - Intronic
1124282919 15:28379220-28379242 CCTTCCCTCCTGCTGCCTCAAGG + Intronic
1124299780 15:28532393-28532415 CCTTCCCTCCTGCTGCCTCAAGG - Intronic
1124321049 15:28711858-28711880 CCTCCCCTCCTGCTGCCTCAAGG - Intronic
1124399610 15:29336775-29336797 CCTGGCCCACAGCTGGCTCCTGG + Intronic
1124434204 15:29634153-29634175 CCTCCCCTACAGCAGGCACTTGG - Intergenic
1124481448 15:30083497-30083519 CCTCCCCTCCTGCTGCCTCAAGG + Intronic
1124487903 15:30135593-30135615 CCTCCCCTCCTGCTGCCTCAAGG + Intronic
1124522147 15:30413697-30413719 CCTCCCCTCCTGCTGCCTCAAGG - Intronic
1124536518 15:30552521-30552543 CCTCCCCTCCTGCTGCCTCAAGG + Intronic
1124542992 15:30604570-30604592 CCTCCCCTCCTGCTGCCTCAAGG + Intronic
1124562952 15:30792013-30792035 CCTCCCCTCCTGCTGCCTCAAGG + Intergenic
1124661514 15:31554143-31554165 CCTGCCCTCCAGCGGCATCCCGG + Intronic
1124755626 15:32402728-32402750 CCTCCCCTCCTGCTGCCTCAAGG - Intronic
1124762135 15:32455071-32455093 CCTCCCCTCCTGCTGCCTCAAGG - Intronic
1124776495 15:32593997-32594019 CCTCCCCTCCTGCTGCCTCAAGG + Intronic
1124960347 15:34389210-34389232 CCTCCCCTCCTGCTGCCTCAAGG - Intronic
1124976976 15:34535431-34535453 CCTCCCCTCCTGCTGCCTCAAGG - Intronic
1125004270 15:34799851-34799873 ACTGCCCTCTGGCTGGATCTGGG + Intergenic
1125601118 15:40916266-40916288 ACTGGCCTCCAGCTGGGTCAGGG - Intergenic
1125616733 15:41020945-41020967 ACAGACCTCCAGCTGGCTCTGGG + Exonic
1126309385 15:47298637-47298659 TCTGCCCTCCAGCAGGCTGCAGG + Intronic
1126869359 15:52971311-52971333 CCTGGCCTCAGGCTGACTCTAGG + Intergenic
1128370822 15:67037892-67037914 CCTGGGCAACAGCTGGCTCTTGG + Intergenic
1128515105 15:68337235-68337257 CCTGCCTTCCAGCTGTCTGTGGG + Intronic
1128515308 15:68338361-68338383 CCTGCCCTCAAGCTGCTTCTGGG - Intronic
1128861681 15:71079514-71079536 ACTGCCTTCCAACTGGCTCTGGG + Intergenic
1129296874 15:74604562-74604584 CTTGCCCTCCAGCTTGAGCTGGG - Intronic
1129314808 15:74735234-74735256 CCTGCTCCCCAGCTTTCTCTGGG - Intergenic
1129697675 15:77749833-77749855 CCAGCCCTCAAGCTGGCCCTTGG - Intronic
1129903581 15:79170387-79170409 CGTGTCTTCCAGCTGGCTGTGGG + Intergenic
1130910629 15:88268444-88268466 GCTTCTCTCCAGCTGACTCTTGG + Intergenic
1130965334 15:88693455-88693477 CCGACCCTCCAGCAGGCCCTGGG - Intergenic
1131054796 15:89368843-89368865 CCCGCCCACCCGCCGGCTCTTGG - Intergenic
1131559711 15:93428844-93428866 CCTGCCCCCAAGCAGACTCTGGG - Intergenic
1131597604 15:93813748-93813770 CCTGCCATCCAGGTGTTTCTGGG - Intergenic
1132403553 15:101528664-101528686 CCAGCCCTGCAGCTGGGCCTGGG + Intergenic
1132433890 15:101781508-101781530 CCTCCCCTCCTGCTGCCTCAAGG - Intergenic
1132585508 16:704464-704486 CCTCCCCTCCAGGCGGCTCCAGG + Intronic
1132725311 16:1335863-1335885 CCAGCCCACTTGCTGGCTCTGGG + Intronic
1132930076 16:2454556-2454578 CCCGCCCTCCACCAGGCCCTGGG + Intronic
1133001465 16:2853575-2853597 CCTGAGCTACAGCTGGCTCTGGG + Intronic
1133178230 16:4032367-4032389 CCTGCCCTCCACCTGCCGCAGGG - Intronic
1133186921 16:4106552-4106574 CCTGTCATCCATCTGGCCCTGGG - Intronic
1133234050 16:4379456-4379478 CGTGCCCTCCAGATGGCCCTGGG - Intronic
1133285849 16:4690354-4690376 GCTGCCCTGCAGCTGGGCCTGGG + Exonic
1133524294 16:6589310-6589332 TCTCCCATACAGCTGGCTCTGGG - Intronic
1134119631 16:11574650-11574672 CCTGCCCAGCACCTGGCCCTGGG + Intronic
1134599481 16:15522177-15522199 CCTGCCACTCAGCTTGCTCTGGG + Intronic
1135928005 16:26712098-26712120 CCTGCAGTAAAGCTGGCTCTAGG + Intergenic
1136096639 16:27961816-27961838 CCTACCCCCCAGCAGCCTCTTGG - Intronic
1136787647 16:32945293-32945315 CCTGCCCCCCGGCTCGCTGTGGG + Intergenic
1136882131 16:33908496-33908518 CCTGCCCCCCGGCTCGCTGTGGG - Intergenic
1137235886 16:46617672-46617694 CCCGCCATCCAGATGGCTCAAGG + Exonic
1137665984 16:50249400-50249422 ACTGCACTCCAGCTTGCTCTGGG + Intronic
1138495522 16:57406687-57406709 CCTAGTCTCCAGCTGGCTCAGGG - Intronic
1139848711 16:69937869-69937891 CCTGCACACCAGCTGGCCCAAGG - Intronic
1141615249 16:85206540-85206562 CCTGGCTTGCAGCTGGATCTGGG - Intergenic
1141629253 16:85277771-85277793 CCTGCCTTCGAGCTGTGTCTGGG + Intergenic
1141839975 16:86568033-86568055 GCTGCCCTGCAGCGCGCTCTCGG - Exonic
1141980591 16:87547682-87547704 CCTGGCCTCTGGCTGGCTGTGGG - Intergenic
1142110282 16:88327498-88327520 CCTGGCCCCTAGCTGGCCCTGGG - Intergenic
1142410748 16:89915413-89915435 GATGCCCTCCAGCTGCATCTTGG + Intronic
1203089878 16_KI270728v1_random:1206950-1206972 CCTGCCCCCCGGCTCGCTGTGGG + Intergenic
1142698200 17:1644989-1645011 CCTGCCCTCTCACTGGCTCCAGG + Intronic
1142894087 17:2963487-2963509 CCTGCCCTGCAGCCTGCTCTGGG + Intronic
1142900451 17:3008239-3008261 TCACCCCTCCAGCTGGCCCTTGG - Intronic
1142973241 17:3627343-3627365 CCTCCCCTCCAGCTCGCTCCGGG + Intronic
1143333265 17:6153567-6153589 CCTGGCTTGCAGCTGGGTCTTGG + Intergenic
1144065738 17:11622574-11622596 CCAGCCCTGCAGATGGCCCTGGG + Intronic
1144215056 17:13048097-13048119 CCTGACCTCCAGCAGGCTGATGG - Intergenic
1144297879 17:13896513-13896535 GCTGCCATCCAACTGGCACTGGG + Intergenic
1147120476 17:38332535-38332557 CCAGCCCCACAGCTGGCCCTAGG + Intronic
1147148002 17:38497413-38497435 CCTGCCCCCCGGCTCGCTGTGGG + Intronic
1147418027 17:40307628-40307650 GCTGGCCTCCAGCTAGCTGTAGG - Intergenic
1147446957 17:40480371-40480393 CCTGCCCTAGAGGTGGTTCTGGG - Intronic
1147585345 17:41651302-41651324 CCTGCCCTCCTGCAGGTTTTGGG - Intergenic
1147586388 17:41655888-41655910 CCTGCCTTTCTGCTGGCTCTGGG + Intergenic
1148180433 17:45601171-45601193 CCCGCCCTCCAGCTGTGTCCTGG - Intergenic
1148221850 17:45868531-45868553 TCTCCCCCACAGCTGGCTCTGGG + Intergenic
1148268467 17:46244723-46244745 CCCGCCCTCCAGCTGTGTCCTGG + Intergenic
1148400589 17:47356758-47356780 CCTGCCCACCACCTGACCCTAGG - Intronic
1149503209 17:57170997-57171019 CCTCTCCTGCAGCTGGCTCTGGG + Intergenic
1150307219 17:64095920-64095942 CCTGCCCTCCAAATGGATGTGGG + Intronic
1150647875 17:66991193-66991215 CCTGGGCTCCAGCTTGATCTCGG + Intronic
1150731573 17:67699588-67699610 TCTGACCTCCAGCTGCATCTTGG + Intergenic
1151337009 17:73445938-73445960 CCAACCCTCCAGCTGGCCCCAGG - Intronic
1151351341 17:73533794-73533816 CCTGCCCTCCAGCTCCTTCAAGG + Intronic
1151706260 17:75769770-75769792 CCAGCCCAGCAGCTGGCACTTGG + Intergenic
1151726602 17:75888685-75888707 CCTGCCCGCCTCCTGGCTGTGGG + Intronic
1153646011 18:7196603-7196625 CCTGCCCTCCAGAGGGCACCTGG + Intergenic
1153736490 18:8074512-8074534 CCTTCCCTCCAGCAGGGTATGGG + Intronic
1154501795 18:15001076-15001098 CTCACCCCCCAGCTGGCTCTGGG - Intergenic
1155174459 18:23290333-23290355 CCTTCCCCGCAGCTGGTTCTGGG - Intronic
1156399037 18:36724394-36724416 GCTGCCCACCAGCTGAATCTGGG + Intronic
1156494262 18:37515698-37515720 GCTGCCCTCCAGCTGGGGCATGG + Intronic
1157114587 18:44851171-44851193 ACTGTCCTTCAGATGGCTCTTGG - Intronic
1157501645 18:48194760-48194782 AATGCCCGCCAGCTGACTCTGGG + Intronic
1157539633 18:48491073-48491095 TCTGCCTTCCAGGAGGCTCTTGG - Intergenic
1157721612 18:49929481-49929503 CGTGCCCGCCAGCTGCCTCCTGG - Intronic
1158524222 18:58197881-58197903 CCTTCCCTCAAGCAGGCTCAGGG - Intronic
1158662624 18:59402401-59402423 GCTGCTCTCCTGCAGGCTCTTGG - Intergenic
1159897820 18:74013284-74013306 CCTGCCCCTCAGCTGCTTCTCGG - Intergenic
1160135072 18:76264770-76264792 CCTGCCCTCCTGGGCGCTCTGGG - Intergenic
1160358169 18:78246335-78246357 CCCAGCCTCCAGCTGGCTCAGGG - Intergenic
1160742738 19:694960-694982 CCGTCCCTCCAGCAGGCTCCTGG - Exonic
1160791075 19:924045-924067 CCTGCCCTCCAGGTGCCTTTCGG + Intergenic
1161412495 19:4124116-4124138 CCTCCCCTCCCCCTGCCTCTCGG - Exonic
1161582984 19:5090856-5090878 CCTGCCCACCAGGTGTCTCCTGG + Intronic
1162043567 19:7984716-7984738 CCTGCCTTCCTGCTGCCTCCAGG - Intronic
1162095471 19:8307506-8307528 CCAACCCTCCAGCTGCCTCTAGG + Intronic
1162555768 19:11384428-11384450 CCTGCCCCCAAGCGGCCTCTGGG - Intronic
1163419432 19:17205896-17205918 CTTCCTCTCCAGCTGTCTCTGGG - Intronic
1163420573 19:17211730-17211752 CCGCTCCTCCAGCAGGCTCTCGG - Exonic
1163591452 19:18196374-18196396 ACTGCCATCCACCTGGCTCTGGG + Exonic
1163795577 19:19335949-19335971 CCTGCCCTGCAGCAAGCTCAAGG + Intronic
1164279649 19:23758525-23758547 CCTGGCCTGCAGCTCTCTCTGGG - Intronic
1164541032 19:29121752-29121774 CCTGCCCTCCTGCTGCTTATGGG + Intergenic
1164852019 19:31491941-31491963 CCTGCCCTCCAGTTGCTCCTTGG + Intergenic
1164938129 19:32230668-32230690 CTTGCCCTCCAGGCAGCTCTGGG - Intergenic
1164995438 19:32717834-32717856 CCTGTCCTCCTGCTTTCTCTAGG - Intergenic
1165176803 19:33936363-33936385 CCCCACCTCCAGGTGGCTCTGGG - Intergenic
1165712871 19:38024538-38024560 ACTGCCCCCCAGCTGGCCCTGGG + Intronic
1166738460 19:45099921-45099943 GCTGGCCCCCAGCTGGCACTCGG + Intronic
1166809698 19:45507841-45507863 CCTCCCCCCCAGCTAGCTCCGGG + Intronic
926122953 2:10254767-10254789 GGAGCCCTCCAGCTGCCTCTGGG - Intergenic
926272775 2:11379050-11379072 CATGGCCTCCTGCAGGCTCTGGG - Intergenic
928172548 2:29012709-29012731 TCTGCCCTCCAGCTGGCAACTGG + Intronic
928367502 2:30713968-30713990 CCTGCTCTCCACCTGGGCCTAGG + Intergenic
928987188 2:37193131-37193153 CCTCCCATGCAGCTGCCTCTGGG - Intronic
929114244 2:38431020-38431042 CCTGCCTTAGAGCTGGGTCTGGG + Intergenic
929541798 2:42828594-42828616 CCCACCCTGCAGCTGGCTCAGGG - Intergenic
929574692 2:43044189-43044211 CCTCCTTCCCAGCTGGCTCTGGG + Intergenic
929860938 2:45676843-45676865 CCTGCCATCAAGCTAGGTCTTGG + Intronic
930027188 2:47036193-47036215 CCTACCCTGCAGCTGGCTGCAGG - Intronic
931678161 2:64718607-64718629 CCTGCCCTCTTGCTTGCTGTTGG - Intronic
932052896 2:68416753-68416775 CCTGCCATTCAGCAGGTTCTGGG + Intergenic
932275332 2:70447829-70447851 CCTGCCCTCTAGTTGGTTCTGGG - Exonic
932343845 2:70983048-70983070 CCTTCCTTCCAGCAGGCACTGGG + Intronic
932800097 2:74734049-74734071 CCTGCCTTCCAACTTCCTCTAGG - Intergenic
934709705 2:96506878-96506900 TCTGCCCCCCAGCTGCCTCATGG - Intronic
935064645 2:99636985-99637007 GGTGTGCTCCAGCTGGCTCTGGG + Intronic
935282796 2:101533721-101533743 CCGGCCCTACAGCTGGCTCCAGG - Intergenic
936084290 2:109455997-109456019 CCTGCCCTGCAGCCTGCTCACGG + Intronic
936680019 2:114759503-114759525 CTTCCCCTCCTGCTGTCTCTTGG + Intronic
937095394 2:119232215-119232237 CCTGCATTCAAGCTGCCTCTGGG - Intronic
937095651 2:119233768-119233790 CCTGGCCTCCACCTGGGCCTAGG - Intronic
937216187 2:120315125-120315147 CCTGCCCTCCAGCGGCTTCTGGG + Intergenic
937774808 2:125763450-125763472 CCTGCCCTCCAGGTGCCCCCTGG - Intergenic
938383054 2:130847373-130847395 CCTGTCTTCCAGATGCCTCTGGG - Intronic
940860445 2:158765306-158765328 CCAGCCCTGCAGATGGCTCATGG + Intergenic
941008374 2:160270346-160270368 CGTGACCCCCATCTGGCTCTCGG + Intronic
943732552 2:191318201-191318223 CCTGCCTCTCAGCTCGCTCTAGG - Intronic
945885706 2:215373505-215373527 CTTCCTCTCCAGCTGGCTGTTGG + Intronic
945950730 2:216036225-216036247 CTGGCCCTTCAGCTGGGTCTTGG - Intronic
946159102 2:217825348-217825370 CCTGCCCTCCAGCTCCCTCCTGG + Intronic
946180199 2:217944215-217944237 GCTGCACTCTAGCTGGCTCTGGG + Intronic
946194499 2:218024977-218024999 CCTGCCATTAGGCTGGCTCTTGG - Intergenic
946969994 2:225080883-225080905 TCTGCCCTGCATCTGGTTCTTGG - Intergenic
948584980 2:239013586-239013608 CCTGGCCTCCAGCTAGCACAGGG - Intergenic
948875194 2:240822743-240822765 CCTGACCTCCAGCTTCCCCTTGG - Intergenic
1168848022 20:958673-958695 CCTGCCCTCCACCTGGCAGCTGG - Exonic
1168926210 20:1581572-1581594 CCTGCCCTACTTCTGTCTCTAGG + Intronic
1169276309 20:4235802-4235824 CCTACCCTCCAGCGTGCTCAGGG + Intronic
1169418823 20:5442770-5442792 CCTGCCCTCCAGGAGGCTGAAGG + Intergenic
1170571544 20:17635545-17635567 CTTGCTCTCCACCTGGCTCGTGG + Exonic
1172510555 20:35497971-35497993 TCTGCCCTGCAGCAGGCCCTGGG + Exonic
1172528525 20:35615846-35615868 CCTGCCCTCCCGCTGTGTCCCGG - Intergenic
1172773945 20:37396610-37396632 CCTCCCTTCCAGCTTACTCTGGG - Intronic
1173853240 20:46232242-46232264 GGAGCCCCCCAGCTGGCTCTGGG + Intronic
1173904887 20:46619263-46619285 CATGTCCTCCAGCTGGATTTGGG + Intronic
1174311817 20:49662043-49662065 CCTGCCCTTCAGCCACCTCTTGG + Intronic
1175167083 20:57051984-57052006 CCTGCCTTCCAGTTGACACTGGG - Intergenic
1175758255 20:61544042-61544064 CCGGCCCCACACCTGGCTCTTGG + Intronic
1175949844 20:62577600-62577622 GCTGCCCTCCAGCTGCCCTTGGG - Intergenic
1176078742 20:63261154-63261176 CCTGCCACCCAGCTGGGTCTAGG - Intronic
1176168232 20:63685611-63685633 GCTGCCCTCCACCTGCCTCCTGG - Intronic
1176272708 20:64244759-64244781 CCTACCCTGCAGCTGCCTCAGGG + Intergenic
1177294242 21:19154402-19154424 CCAGCCTTCCTGCTGGCTGTTGG - Intergenic
1178092422 21:29178895-29178917 CCTTCCCACCTGCTGTCTCTTGG + Intergenic
1179098290 21:38335039-38335061 CATGGACTCCAGATGGCTCTTGG - Intergenic
1179248229 21:39651375-39651397 CAGGCCCTCCCGCAGGCTCTGGG + Intronic
1179577965 21:42319563-42319585 CCTGCTGCCCAGCTGTCTCTCGG + Intergenic
1179639327 21:42736818-42736840 CCTGAACTCCACCTGGCTTTGGG + Intronic
1179711693 21:43267273-43267295 CCTGGCCTCCTGCTGGCCCTGGG + Intergenic
1179906680 21:44426430-44426452 CCTGCCCTTCAGCTGGCCCCAGG + Intronic
1180463451 22:15589136-15589158 CCTTCCCTCCACCTGGCCCCTGG + Intergenic
1180736875 22:18023998-18024020 CCTGCTCTCTGGCAGGCTCTGGG + Intronic
1181026020 22:20128198-20128220 CGTGCCCTCCACCTGGGCCTGGG + Intergenic
1181132681 22:20742523-20742545 CCAGTACTCCAGCTGGCTATGGG + Intronic
1181588250 22:23866312-23866334 AGTGCCCACCAGCTGCCTCTCGG - Intronic
1181779388 22:25181839-25181861 CATGCCCACCAGGTGACTCTTGG - Intronic
1181783577 22:25209640-25209662 CCTGCCTTCCATCTGTCTCATGG - Intergenic
1181864126 22:25841795-25841817 CCTGCTCTCCAGTTGCTTCTAGG + Intronic
1182031276 22:27161192-27161214 ACTGTCCTCCAGCTGGCTTTTGG + Intergenic
1182359519 22:29738374-29738396 CCAGTCCTCCAGATGGCCCTCGG + Exonic
1182779064 22:32852937-32852959 CATGCTCTCCAGCTGGCTGCAGG + Intronic
1183198917 22:36372657-36372679 CCTCCCCTCCAGCCTGCTCTTGG - Intronic
1183366018 22:37407268-37407290 CGTGCCCTCCAGCTCGCTTGTGG - Intronic
1183619631 22:38964953-38964975 CCTTCCCTCCAGCTGGCCCAGGG + Intronic
1183658656 22:39205753-39205775 CCTCCCCTCCAGCTGGAACCTGG - Intergenic
1183896186 22:40971080-40971102 TCTGCCCTACAGCAGGCTCAAGG + Intronic
1184379611 22:44136942-44136964 CCTGCCCTCTGGCTTTCTCTAGG - Intronic
1184858721 22:47161062-47161084 CCTGCCTCCCAGCTGGCCCTGGG + Intronic
1185310697 22:50152720-50152742 CCTGCCCTCCACCCGGCTGCTGG + Intronic
949599283 3:5580805-5580827 TCTGCCCTCCAGCCTCCTCTGGG - Intergenic
950431850 3:12955421-12955443 CCCCCCTGCCAGCTGGCTCTCGG - Intronic
950480446 3:13240425-13240447 CCTGCCCTCCACCTAGCCCTGGG - Intergenic
952740853 3:36733095-36733117 TCTGGCCTCCTGCTGGTTCTAGG - Intronic
953019638 3:39105256-39105278 CCTGCCATCCAGCTCCCTCAGGG + Intronic
953571166 3:44072984-44073006 GCTGCCCTGCAGCTTGCTGTTGG + Intergenic
954420701 3:50417613-50417635 CATGCCTTCCTCCTGGCTCTGGG - Intronic
955219652 3:57012964-57012986 CCTGCACTCCTGCTGGCCCTGGG + Intronic
955329614 3:58036294-58036316 CCTCCCACACAGCTGGCTCTGGG - Intronic
955357855 3:58246408-58246430 CCTGCCTTCCAGCTGAGCCTCGG + Intronic
955495825 3:59531243-59531265 GCTCCCTTCCAGCTCGCTCTGGG - Intergenic
959625127 3:108441186-108441208 TCTGGCCTCCAGCTGGATCTTGG + Exonic
960705261 3:120475341-120475363 CCTGGCCTCAAGCTGGCTCCTGG - Intergenic
961511541 3:127406780-127406802 CATGCCCTCCTGAGGGCTCTAGG - Intergenic
961780637 3:129318264-129318286 CCTCCCCTCCACCTGGTTCCAGG - Intergenic
961838371 3:129684437-129684459 CCATCCCTCCAGGTGGCACTAGG + Intronic
962395185 3:135009256-135009278 CCTGTCCTCCTCATGGCTCTGGG - Intronic
963928655 3:150978860-150978882 TCTCCCCACCATCTGGCTCTTGG + Intergenic
964221745 3:154354720-154354742 CCTGTCCTTCTTCTGGCTCTCGG + Intronic
964791032 3:160453224-160453246 ACTGCTCTCCAGGTGGCTCCGGG - Intronic
967071582 3:185967103-185967125 CGTGCCCTCAAGTTGGTTCTGGG - Intergenic
967221047 3:187248396-187248418 CCTGCCCTCAAGATTGCTGTGGG - Intronic
968009868 3:195267237-195267259 TCTTCCCTTCAGTTGGCTCTGGG - Intronic
968728113 4:2257570-2257592 GCTGCCCTCCATCTGCCCCTCGG + Intronic
968927653 4:3558323-3558345 CAGGCCCTCCAGCTGGCCCTCGG - Intergenic
969265806 4:6063503-6063525 CCCTCCCTCCAGCCGGCACTTGG + Intronic
969669105 4:8580014-8580036 CCTGTCCTTCACCTGGCTCCTGG - Intronic
971365941 4:25977227-25977249 CCTGCCATGTAGCAGGCTCTTGG + Intergenic
976505591 4:85842762-85842784 TCTGCCAGCCAGCTGGCACTAGG + Intronic
978408072 4:108400211-108400233 CCTGCCCTCCCTCAGCCTCTGGG + Intergenic
979860325 4:125685583-125685605 CCTGCCCTGCACCAGGTTCTAGG + Intergenic
982000324 4:151015840-151015862 CCAGCACTCCGGCTGGCTCGGGG - Intergenic
983247845 4:165309106-165309128 CCTGCCCTCAGGCTGGCACAGGG + Intronic
984285498 4:177723419-177723441 CCTGCCCACCTGCTTGCTTTTGG + Intergenic
985569834 5:638938-638960 GCCGCCCTCCACCTGGCTCAGGG + Intronic
985696574 5:1344512-1344534 TCCGCCCTCCAGCTGGCCGTGGG - Intronic
986398994 5:7361154-7361176 CTTGCCCTCCTGGAGGCTCTAGG - Intergenic
987740915 5:21907659-21907681 CCTGCCCTAGGGCTGGCTCTAGG - Intronic
989213059 5:38876794-38876816 CCTGCACTTCAGCTGGGTATAGG - Intronic
992217340 5:74538974-74538996 CTTGCCTTCCATGTGGCTCTAGG - Intergenic
992530947 5:77651110-77651132 CCTGCCCACCAGCTGCATCCAGG - Intergenic
996846240 5:127902232-127902254 CCTGCACTCCAGCTTGGCCTGGG + Intergenic
997345607 5:133189802-133189824 CCTGCCCTGCCCCTGTCTCTGGG + Intergenic
998006294 5:138659276-138659298 CCTGCCCGCCAGCTGACCCCAGG - Intronic
1000121588 5:158203138-158203160 CCTGCTCTCCAGCTGGGCTTTGG + Intergenic
1001082383 5:168676875-168676897 CCTGCCTGGCAGCTGGCTCCAGG + Intronic
1001231215 5:169990440-169990462 CCTGACATCCAGCTGGCTGCAGG + Intronic
1001296759 5:170504128-170504150 CCTGCGCTCGGGCTGGGTCTCGG - Intronic
1001768467 5:174273867-174273889 CATGATCTCCAGGTGGCTCTTGG + Intergenic
1002521230 5:179794201-179794223 TCTGCCCTCCACCTGGGCCTAGG - Intronic
1003339215 6:5203743-5203765 CCTGCCCAGCTGCAGGCTCTCGG - Intronic
1003646362 6:7915822-7915844 CCTGACCTCCAGCTGGGGTTAGG + Intronic
1004404363 6:15318281-15318303 CGTGTCCTCCAGCTGGGCCTTGG - Intronic
1004714370 6:18203120-18203142 CCTGGCCTACAGCTTGTTCTAGG - Intronic
1005405027 6:25477514-25477536 CCTGTTCACCAGCTTGCTCTTGG + Intronic
1005771082 6:29072256-29072278 CTTGCCGTCCAGCTGCCACTAGG - Intronic
1005968352 6:30742790-30742812 CCCGCCCGCCCGCTGGCTCTCGG + Intergenic
1006300530 6:33191613-33191635 GCTGCCACGCAGCTGGCTCTGGG - Intronic
1006896978 6:37477516-37477538 CCTGCCTCCCAGCTGCCTCCTGG + Intronic
1007924555 6:45640901-45640923 CCTGCCCTCCACCTTGCTCCTGG - Intronic
1008730887 6:54481294-54481316 CCAGCACTCCAGCTGGCCATCGG - Intergenic
1009059297 6:58378360-58378382 TCTGCCCTCAAATTGGCTCTGGG + Intergenic
1009231550 6:61068765-61068787 TCTGCCCTCAAATTGGCTCTGGG - Intergenic
1013178892 6:107701357-107701379 CCTGGGCTCCAGGTGACTCTCGG - Intergenic
1013375065 6:109506978-109507000 CCTGCCCACCTCATGGCTCTTGG - Intronic
1014744311 6:125182099-125182121 CCTGCCTTTCAAGTGGCTCTTGG - Intronic
1015176494 6:130314877-130314899 AATGCCCTCCAGCTGCTTCTAGG + Intronic
1016680232 6:146820649-146820671 CCTCCCCTGTTGCTGGCTCTGGG + Intergenic
1016793827 6:148096164-148096186 CCTGCCATCCAGCTTTCCCTTGG - Intergenic
1017749692 6:157479813-157479835 CCAGCCTTCCAGCTCTCTCTGGG - Intronic
1017958942 6:159205004-159205026 CCTGCCCTCCTGCTGGCTCTAGG + Intronic
1018806494 6:167266010-167266032 CCTGCCCCGCAGATGGCTCCTGG + Intergenic
1019163608 6:170084993-170085015 CCTGCCTTCCAGGTGGCCATGGG - Intergenic
1019518756 7:1451205-1451227 CGTGACCTCCAGCTGGTCCTGGG + Intronic
1021717318 7:23471307-23471329 CCTGCGCTCGCGGTGGCTCTCGG + Intergenic
1024280611 7:47716022-47716044 CCGGCTCTCCAGCTGGATCTAGG + Intronic
1024511910 7:50211479-50211501 CCTGCCCTCCAGTTGGCAGGAGG + Intergenic
1025190733 7:56893646-56893668 CCTCCCCTCCTGCTGGCCTTGGG - Intergenic
1025681210 7:63683278-63683300 CCTCCCCTCCTGCTGGCCTTGGG + Intergenic
1026109876 7:67450617-67450639 CCTGCACTCCAGCTGGGTGATGG - Intergenic
1026385720 7:69845735-69845757 TCTCACCTCCAGCTTGCTCTAGG - Intronic
1026845111 7:73694334-73694356 GCTGCCCTCCACCTGCATCTGGG + Intronic
1026896488 7:74012877-74012899 CCTGCACTCCAGCTGCCTGGAGG - Intergenic
1029470901 7:100753405-100753427 CCTGCCATCCCTCTCGCTCTGGG - Intronic
1030289351 7:107856914-107856936 CCTTCCCTGGAGCAGGCTCTCGG + Intergenic
1030688804 7:112511959-112511981 CCTGCTCTGCGGCTGGCTCTGGG + Intergenic
1030954044 7:115828847-115828869 CCTCCCCTTCAGATGCCTCTTGG - Intergenic
1032823110 7:135542985-135543007 GCTGCCCTCCTGCTAGCTCCTGG - Intergenic
1034064645 7:148124508-148124530 CCTGCCCTACTGCTGGTGCTGGG + Intronic
1035225940 7:157432229-157432251 CCGTCCCTCCAGCAGCCTCTGGG - Intergenic
1036757706 8:11482255-11482277 CTTCCCCTGCAGGTGGCTCTGGG + Intergenic
1036777890 8:11625957-11625979 CCTGCTCTCAGGCTGTCTCTTGG - Intergenic
1037814539 8:22104952-22104974 CCTGCCCTCCCGCAGTCTCTTGG - Intergenic
1037859884 8:22397675-22397697 CCTGGGCTCCAGATGGCTCTTGG + Intronic
1037881424 8:22575203-22575225 TCTGGCCTCCAGCTGGGTGTGGG + Exonic
1041459024 8:58091427-58091449 CCTGCCGTCCAGCAGGGCCTTGG - Intronic
1041863028 8:62535702-62535724 CCTACCCTCCAGCAGCCTCCAGG + Intronic
1044137681 8:88608360-88608382 GCTGCCCTGCAGATGGCTGTGGG + Intergenic
1044543063 8:93429393-93429415 CTTGCTCCCCAGATGGCTCTTGG - Intergenic
1044742208 8:95339614-95339636 CCTGGTAGCCAGCTGGCTCTTGG - Intergenic
1045676642 8:104614893-104614915 CCTGCCATCCAGATGCTTCTTGG + Intronic
1046718357 8:117591752-117591774 CCTGCTCTCCAGCTGTTTTTAGG - Intergenic
1047740181 8:127800400-127800422 TCTGTCCCCCAGCTGTCTCTGGG - Intergenic
1048195393 8:132328010-132328032 CATGCCCCCATGCTGGCTCTGGG - Intronic
1048206293 8:132417911-132417933 GCTGCCCTCTGGCTGGCTCATGG - Intronic
1049003968 8:139843276-139843298 GCCGCCCTCCTGCTGGCTCTGGG - Intronic
1049172541 8:141170704-141170726 CCTGCCCCCCAGGTGGCTCCTGG - Intronic
1049272008 8:141700959-141700981 CCTGCCCCACAGCTGGCAGTGGG + Intergenic
1049425238 8:142535255-142535277 CCTCTGCTCCAGCTGGCCCTGGG - Intronic
1049427751 8:142544869-142544891 TGTGCCCTCCACCTGGGTCTAGG - Exonic
1049794750 8:144492037-144492059 CCTGCCCTCCAGCTGGCTCTGGG - Intronic
1049794766 8:144492084-144492106 CCTGCCCTCCGGCTGGTTCTGGG - Intronic
1050737762 9:8783797-8783819 CCTGCCCTCCTGCTCTATCTGGG - Intronic
1051449586 9:17180240-17180262 CCTGCCTTCCTGTTGGCTATTGG + Intronic
1051544199 9:18255801-18255823 CCTGGTCTCCAGCTGGCCCTTGG + Intergenic
1051606650 9:18923516-18923538 CACCCCCTCCAACTGGCTCTAGG + Intergenic
1051741470 9:20256538-20256560 CCTGCCCTACTGCTACCTCTTGG + Intergenic
1053379415 9:37636439-37636461 CCTGCTCTGCTGCTGCCTCTAGG - Intronic
1053596202 9:39564015-39564037 TCTGCCCTCCAGGTGGTTTTAGG + Intergenic
1053610660 9:39709988-39710010 CCTCCCCTCCAGGGGGTTCTGGG - Intergenic
1053802512 9:41773402-41773424 CAGGCCCTCCAGCTGGCCCTCGG - Intergenic
1053854170 9:42320656-42320678 TCTGCCCTCCAGGTGGTTTTAGG + Intergenic
1053868695 9:42468010-42468032 CCTCCCCTCCAGGGGGTTCTGGG - Intergenic
1054087593 9:60761169-60761191 CCTCCCCTCCAGGGGGTTCTGGG + Intergenic
1054142725 9:61541668-61541690 CAGGCCCTCCAGCTGGCCCTCGG + Intergenic
1054190820 9:61984748-61984770 CAGGCCCTCCAGCTGGCCCTCGG - Intergenic
1054242862 9:62632407-62632429 CCTCCCCTCCAGGGGGTTCTGGG + Intergenic
1054462476 9:65472818-65472840 CAGGCCCTCCAGCTGGCCCTCGG + Intergenic
1054556987 9:66666925-66666947 CCTCCCCTCCAGGGGGTTCTGGG + Intergenic
1054570054 9:66801002-66801024 TCTGCCCTCCAGGTGGTTTTAGG - Intergenic
1054647553 9:67602969-67602991 CAGGCCCTCCAGCTGGCCCTCGG + Intergenic
1056135130 9:83623382-83623404 CCCGCCCTCCAGCCTGCTCGCGG + Intronic
1056396280 9:86184316-86184338 CCAGACTTCCAGCTGGCTCCAGG - Intergenic
1056617018 9:88177511-88177533 CATGCCCTCCCGCTGACTTTTGG - Intergenic
1057270886 9:93650754-93650776 TCTGCCCTCCAGCTGGCCCCTGG + Intronic
1058416707 9:104796236-104796258 CCTGCCCTCCTTCTGACACTGGG + Intronic
1058699259 9:107587495-107587517 CCCGCCCTACAGCTGCCTATAGG + Intergenic
1059418505 9:114176596-114176618 TCTCCTCTCCAGCTGTCTCTGGG - Intronic
1060209352 9:121700307-121700329 CCTGTCCTCCAGGGGGCACTGGG + Intronic
1060263149 9:122093110-122093132 CCGGGCCGCCAGCTCGCTCTCGG + Exonic
1060527003 9:124326463-124326485 CCTGGGCTCCAGGTGGCTCCGGG - Intronic
1060937958 9:127526888-127526910 CAGTCCCTCCAGCTGGCTCCAGG - Intronic
1061257516 9:129461020-129461042 CCTGCCCTCCAGGAGCCCCTGGG + Intergenic
1061300794 9:129703889-129703911 CCTGCCGTGCCCCTGGCTCTGGG - Intronic
1061543520 9:131290726-131290748 CCTCCCTTCAAGCTGCCTCTGGG - Intronic
1061595491 9:131626269-131626291 CCTCCTTTCCAGCTGCCTCTTGG - Exonic
1061679783 9:132237317-132237339 CCTGCCCTAGAGCTGGCCCAGGG + Intronic
1062068887 9:134544623-134544645 CCGGCCCTGCAGCTTTCTCTAGG + Intergenic
1062424685 9:136500633-136500655 GCTGGCCTCCAGCAGGCGCTTGG + Exonic
1062498694 9:136843272-136843294 CGCACCCCCCAGCTGGCTCTGGG + Intronic
1062568191 9:137172544-137172566 GCTGGGCTCCAGCTGGCTGTAGG + Intergenic
1062574490 9:137200033-137200055 CCTGCTCTCCAACGGGCACTCGG - Exonic
1186600377 X:11030381-11030403 CCTGCTCTCAATCTGGCTTTGGG - Intergenic
1187968076 X:24632306-24632328 CTTGCCATCCTTCTGGCTCTTGG - Intronic
1188346464 X:29072600-29072622 CCTCACCTCCTGCTGGTTCTTGG + Intronic
1189757108 X:44283022-44283044 CCTGTCCTCCAGCTGGCCGTTGG + Intronic
1189873015 X:45404363-45404385 CCTGCCATCCAGGTGCTTCTTGG - Intergenic
1192146506 X:68686379-68686401 CCGGCTCGCCAGCTCGCTCTTGG + Intronic
1194147255 X:90279737-90279759 CCTACACTCCAGTTGGCTCCTGG - Intergenic
1195004414 X:100671883-100671905 GGGGCCCTCCAGCTGGCTCACGG + Intergenic
1200493659 Y:3856505-3856527 CCTACACTCCAGTTGGCTCCTGG - Intergenic