ID: 1049794752

View in Genome Browser
Species Human (GRCh38)
Location 8:144492038-144492060
Sequence GCCTGCCCTCCAGCTGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 6, 3: 41, 4: 342}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049794752_1049794761 15 Left 1049794752 8:144492038-144492060 CCAGAGCCAGCTGGAGGGCAGGC 0: 1
1: 0
2: 6
3: 41
4: 342
Right 1049794761 8:144492076-144492098 GGCTGGCCCCCAGAACCAGCCGG No data
1049794752_1049794767 23 Left 1049794752 8:144492038-144492060 CCAGAGCCAGCTGGAGGGCAGGC 0: 1
1: 0
2: 6
3: 41
4: 342
Right 1049794767 8:144492084-144492106 CCCAGAACCAGCCGGAGGGCAGG No data
1049794752_1049794762 18 Left 1049794752 8:144492038-144492060 CCAGAGCCAGCTGGAGGGCAGGC 0: 1
1: 0
2: 6
3: 41
4: 342
Right 1049794762 8:144492079-144492101 TGGCCCCCAGAACCAGCCGGAGG No data
1049794752_1049794759 -6 Left 1049794752 8:144492038-144492060 CCAGAGCCAGCTGGAGGGCAGGC 0: 1
1: 0
2: 6
3: 41
4: 342
Right 1049794759 8:144492055-144492077 GCAGGCAATGTGGGGGCGCTGGG No data
1049794752_1049794760 -2 Left 1049794752 8:144492038-144492060 CCAGAGCCAGCTGGAGGGCAGGC 0: 1
1: 0
2: 6
3: 41
4: 342
Right 1049794760 8:144492059-144492081 GCAATGTGGGGGCGCTGGGCTGG No data
1049794752_1049794769 26 Left 1049794752 8:144492038-144492060 CCAGAGCCAGCTGGAGGGCAGGC 0: 1
1: 0
2: 6
3: 41
4: 342
Right 1049794769 8:144492087-144492109 AGAACCAGCCGGAGGGCAGGTGG No data
1049794752_1049794763 19 Left 1049794752 8:144492038-144492060 CCAGAGCCAGCTGGAGGGCAGGC 0: 1
1: 0
2: 6
3: 41
4: 342
Right 1049794763 8:144492080-144492102 GGCCCCCAGAACCAGCCGGAGGG No data
1049794752_1049794758 -7 Left 1049794752 8:144492038-144492060 CCAGAGCCAGCTGGAGGGCAGGC 0: 1
1: 0
2: 6
3: 41
4: 342
Right 1049794758 8:144492054-144492076 GGCAGGCAATGTGGGGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049794752 Original CRISPR GCCTGCCCTCCAGCTGGCTC TGG (reversed) Intronic
900092833 1:927880-927902 ACCTGCCCTCCAGGTGCCTTGGG + Intronic
900393096 1:2442341-2442363 CCCTGCCCACCATCTGGCCCTGG - Intronic
901025543 1:6277032-6277054 GACTGCTCCCCAGCTGGCTCTGG + Intronic
901497125 1:9628745-9628767 TCTTCCCCTCCAGCTGCCTCTGG - Intergenic
901529992 1:9846779-9846801 GCCTGGCCCCCTGCTGTCTCCGG + Intergenic
901530006 1:9846830-9846852 GCCTGGCCCCCTGCTGTCTCTGG + Intergenic
901668540 1:10840107-10840129 GCCTGCCCTCTGGGTGGCTGTGG - Intergenic
901841435 1:11956485-11956507 GCCTCCCCTGCATGTGGCTCTGG + Intronic
902368077 1:15990289-15990311 TCCTGCCCTCCAGCTGCCCTTGG + Intergenic
902737059 1:18408193-18408215 CCCTCCCCTCCTGCAGGCTCCGG + Intergenic
902779525 1:18695619-18695641 GGCTGCCCTTCATGTGGCTCTGG - Intronic
903126951 1:21254825-21254847 GCCTGGCCTCCTGCTGGTGCTGG - Intronic
903331322 1:22598476-22598498 GCATGCCCCCCAGCTGGGTGGGG - Intronic
903545300 1:24120250-24120272 TCCTGCCGTCCTGCTGGCCCTGG + Exonic
904002268 1:27345496-27345518 GCCCCTCCTCCAGCTGGCGCAGG - Exonic
904011746 1:27393826-27393848 GCCTGGCTCTCAGCTGGCTCAGG + Exonic
904212247 1:28893653-28893675 CCCTGCCCTCCCTCTGCCTCTGG - Intronic
904268353 1:29331159-29331181 TCCTGCGCTCCCGCTGACTCAGG - Intergenic
904401513 1:30259805-30259827 TCCTGCCCTCCAGGTCGCCCTGG + Intergenic
904852363 1:33468591-33468613 GACTGCCCTCCAGCTGGCCGGGG + Intergenic
904873009 1:33633609-33633631 GGCTGCCCTCCTCCTGGCTTGGG - Intronic
906409422 1:45566940-45566962 GCCTGCCCTCCGGAAGACTCTGG + Exonic
907333236 1:53684812-53684834 GCCTGCCCTAAAGCAGGCCCAGG - Intronic
907832559 1:58078959-58078981 GCCTGCTCTCCAGATGGCCTTGG - Intronic
913294071 1:117301869-117301891 GCCTGCCCTCCTGCAGACCCAGG + Intergenic
913550839 1:119915721-119915743 ACCTGCCCTCCAGCTGTTGCGGG - Exonic
915558906 1:156675331-156675353 GCCTGCCCTGCAGCTGGCTGTGG - Exonic
917167093 1:172124580-172124602 ACATGCTTTCCAGCTGGCTCTGG - Intronic
919005620 1:191895780-191895802 GCCTGCCCTCCAGGTGGAGTGGG - Intergenic
919762957 1:201110013-201110035 GCCAGCCCTGCAGGTGGCTGGGG + Intronic
919920664 1:202164743-202164765 GCCTGGCCTACAGCTGTCCCAGG - Intergenic
920075679 1:203334760-203334782 GCATGCCCTCAAGCTTGGTCTGG + Intergenic
920309737 1:205042034-205042056 GCCTGCTGTCCAGCTTGCACAGG - Intergenic
920516396 1:206587610-206587632 GCCTGCCCTGGCCCTGGCTCTGG + Exonic
921222357 1:212982104-212982126 ACCCTCCGTCCAGCTGGCTCCGG + Intronic
922574126 1:226651105-226651127 GTCTGGCCCCCAGCTGTCTCTGG - Intronic
922593850 1:226798835-226798857 GCCTGCCCTCCCACTGTCCCAGG + Intergenic
923967347 1:239156427-239156449 GCCTTCCTTCCACCTGGCTATGG + Intergenic
924090682 1:240497771-240497793 GCCACGCTTCCAGCTGGCTCAGG + Intronic
1062822765 10:547378-547400 GCCTGCCTCACAGCTGGCTGTGG - Intronic
1062858210 10:790100-790122 CCCTGACCTCCAGCAGGCACTGG + Intergenic
1062958233 10:1554136-1554158 GCCTGCCCTGCAGATGGGTGGGG - Intronic
1063426241 10:5952242-5952264 GCCTTGCCTAAAGCTGGCTCCGG - Intronic
1063978876 10:11437918-11437940 GCCTCGCCTCCAGGAGGCTCTGG + Intergenic
1065009375 10:21407753-21407775 CCCTGCAGTCCAGCTGTCTCTGG + Intergenic
1066063962 10:31749366-31749388 GCCCGCCCACCTGCTGCCTCGGG - Intergenic
1066186974 10:33019428-33019450 GCTTTCCCTCAGGCTGGCTCTGG - Intergenic
1066460977 10:35611943-35611965 GCCTGGCCTCGAGATGGCGCTGG + Intergenic
1069614099 10:69795530-69795552 GCCAGCCCCCATGCTGGCTCAGG + Intergenic
1069630929 10:69896654-69896676 GCCTGCCTTCCAGCTTCCTGAGG - Intronic
1069858915 10:71458075-71458097 GAATACCCTCCAGCTGGCTGAGG + Intronic
1070213724 10:74353394-74353416 CCCTACCCACCAGCTGGCCCAGG - Intronic
1070797117 10:79223301-79223323 GCCTGCCTGCCTGCTGTCTCTGG - Intronic
1072227900 10:93387213-93387235 GCCAGCCCCCCAGCTGCCCCAGG - Intronic
1072755775 10:98019801-98019823 GCCTGCCAGGCAGCTGCCTCTGG + Intronic
1073445368 10:103577076-103577098 CCCAGCCCAACAGCTGGCTCAGG - Intronic
1075071889 10:119325330-119325352 ACCTGTCCTCCACCTTGCTCTGG - Intronic
1075881853 10:125859350-125859372 AACTTCCCTCCAGCAGGCTCAGG - Intronic
1076362560 10:129899599-129899621 GCCTTCCCTCCGGCTGGATCTGG - Intronic
1076852371 10:133099371-133099393 GCTTGCCCTCCTGGTGACTCAGG - Intronic
1077167962 11:1152252-1152274 GTCTGCCCTCCAGCAGCATCAGG - Intergenic
1077343148 11:2034957-2034979 TGCCTCCCTCCAGCTGGCTCCGG + Intergenic
1077373476 11:2194509-2194531 TCCTGCCGCCCAGCTGGATCTGG + Intergenic
1081062583 11:38499021-38499043 GCCTGGCCTCCATCTGTCTCTGG + Intergenic
1081810922 11:45913779-45913801 GCCAGCCCTCTCCCTGGCTCAGG + Intronic
1083431670 11:62616565-62616587 GACTGCTCTCCAGGTGGCCCCGG + Exonic
1083579982 11:63818643-63818665 GCCTCCCCTTCACCTGGGTCAGG - Exonic
1083708315 11:64531668-64531690 GCCTGGCATGCAGCAGGCTCAGG + Intergenic
1084310197 11:68312460-68312482 GCCTGGCCGCCGGCCGGCTCCGG + Intergenic
1084421741 11:69063849-69063871 GCCTGCCCGCCGCCTGGCCCAGG + Intronic
1084525819 11:69697431-69697453 GCCTGCCGTGCAGCTGGGGCTGG + Intergenic
1084694525 11:70745682-70745704 GCCTGGCCCCCACCTGGCCCAGG + Intronic
1084742029 11:71146257-71146279 GACTGGCCCCCAGCTTGCTCTGG + Intronic
1085052828 11:73388618-73388640 GCCTTCACTCCTGCTGGTTCTGG - Intronic
1087086436 11:94223517-94223539 GCCTACCCTCCTGCAGCCTCTGG + Intergenic
1088972995 11:114789908-114789930 GCATGCCTGCCAGGTGGCTCCGG - Intergenic
1089286426 11:117410853-117410875 GCCTGCTCTCCAGCGGGGTGGGG - Exonic
1089870177 11:121665563-121665585 GCCTGACATCCAGGTGGCCCTGG + Intergenic
1090028462 11:123187205-123187227 GCCTGGCTTCCAGCAGGGTCTGG + Intronic
1090077902 11:123590981-123591003 CCCGGACCTCCAGCTGGCCCTGG + Intronic
1202826134 11_KI270721v1_random:90146-90168 TGCCTCCCTCCAGCTGGCTCCGG + Intergenic
1091554176 12:1559784-1559806 GGCTGTGCTCCAGCTGCCTCTGG + Intronic
1091634018 12:2183732-2183754 GCCTTCCCGCCAGGTGGGTCAGG + Intronic
1091671796 12:2457323-2457345 GCCTGCCCCTCAGCTCGCTCAGG + Intronic
1091761923 12:3093222-3093244 GCCCACCTTCCAGCTGGCTTTGG + Intronic
1091831008 12:3551247-3551269 GGCTGCCCTCAAGCTGCCTCAGG + Intronic
1091930646 12:4392639-4392661 CCCTGACCTCCAGCAGGCTGAGG - Intergenic
1092028244 12:5261285-5261307 TCTTGCCCTCCAGCTGCCTCTGG - Intergenic
1092989313 12:13879796-13879818 GCCTGGCCTGCAGCTGTGTCCGG - Intronic
1097050679 12:56221489-56221511 GCCGGTCCTCCAGCTAGCCCCGG + Intronic
1097268410 12:57759122-57759144 GCCTGCCCACCGGCCGTCTCTGG - Exonic
1097319428 12:58208791-58208813 GCCTGCCCCACACCTGGCCCAGG - Intergenic
1101269451 12:103128333-103128355 TCCTGCCCTGCACCTGGCTCAGG + Intergenic
1103209181 12:119154351-119154373 TCCGGGCCTCCAGGTGGCTCGGG - Exonic
1103621352 12:122189278-122189300 GCATGCCCTCCAGGTTCCTCGGG - Intronic
1103826991 12:123746971-123746993 GCCTGCCCTTCAGGTGGGTTAGG - Intronic
1103848233 12:123914562-123914584 CCCCTCCCTCCTGCTGGCTCAGG - Intronic
1103897983 12:124286503-124286525 CCCTGCCCTCCGGCTGGGCCTGG + Intronic
1104378731 12:128288441-128288463 CCCTCCCCTGCAGCTGGGTCTGG + Intronic
1104637828 12:130449074-130449096 CCCTGCCCTTCAGCTGGCATCGG - Intronic
1104730723 12:131103935-131103957 CCCTGCGCTCCAGGAGGCTCCGG - Intronic
1104917732 12:132274480-132274502 CCCTGCTCTCCTGCTGGCTGGGG + Intronic
1108035345 13:46285171-46285193 GCCTGGCTTCCTGCAGGCTCAGG + Intergenic
1109062516 13:57634954-57634976 GCCTGCCCCTCAGCTCGCCCCGG + Exonic
1112384866 13:98930328-98930350 GTGTGCCCTGCAGCTGGCCCTGG + Intronic
1112580613 13:100674318-100674340 GCCTGGCCGCCAGCTGGCCGCGG - Intronic
1113708384 13:112448349-112448371 TCCTGGTCCCCAGCTGGCTCAGG - Intergenic
1116467739 14:45253232-45253254 GCCCGCCCTCCAGCCAGCCCGGG + Exonic
1118852599 14:69595581-69595603 ATCTGCCCTCCCGCTGCCTCTGG + Intergenic
1119424181 14:74525044-74525066 CCCTGCCCTGGAGTTGGCTCTGG + Intronic
1120368969 14:83607723-83607745 GTCTTTCCTCCGGCTGGCTCTGG - Intergenic
1121485977 14:94314595-94314617 GGCTGCCCACCAGCGGCCTCTGG - Exonic
1123053585 14:105559318-105559340 GCCTGCCCGGGAGCCGGCTCGGG - Intergenic
1123078163 14:105679733-105679755 GCCTGCCCGGGAGCCGGCTCGGG - Intergenic
1124023684 15:25945586-25945608 GCCTGGCCTCCAGCTCCTTCAGG - Intergenic
1124596691 15:31097195-31097217 GCCTGCCCTCCAGTGGGAGCAGG + Intronic
1125520706 15:40346442-40346464 GCCTGGGCTCCACCTTGCTCTGG - Intergenic
1125601119 15:40916267-40916289 AACTGGCCTCCAGCTGGGTCAGG - Intergenic
1125616732 15:41020944-41020966 CACAGACCTCCAGCTGGCTCTGG + Exonic
1125766860 15:42142019-42142041 GTGCGCCCTCCAGCTGGCTCTGG - Exonic
1128239199 15:66089458-66089480 GCCTGCCCTCCAGAAGGCCTGGG - Intronic
1128515103 15:68337234-68337256 TCCTGCCTTCCAGCTGTCTGTGG + Intronic
1128515310 15:68338362-68338384 GCCTGCCCTCAAGCTGCTTCTGG - Intronic
1128861680 15:71079513-71079535 CACTGCCTTCCAACTGGCTCTGG + Intergenic
1129903580 15:79170386-79170408 GCGTGTCTTCCAGCTGGCTGTGG + Intergenic
1130889543 15:88121733-88121755 GCCAGCCCTCCTGCTGGAGCAGG - Intronic
1130908994 15:88258086-88258108 GCCTGCCCTCCTCCAAGCTCGGG - Intergenic
1131559713 15:93428845-93428867 GCCTGCCCCCAAGCAGACTCTGG - Intergenic
1132089020 15:98932755-98932777 CTCTGCCCTCCAGCTGGCATAGG - Intronic
1132104293 15:99051538-99051560 GCCAGGCAGCCAGCTGGCTCAGG + Intergenic
1132589645 16:721070-721092 GGCTGCCCTCCCGCGGGTTCCGG - Exonic
1132657038 16:1045747-1045769 GCCTGCCCTCCAGGTGCTCCCGG + Intergenic
1132847568 16:2007459-2007481 TCTTGCTCTCCAGCTTGCTCTGG - Intronic
1132873709 16:2126627-2126649 GCCTGCGCTCCAGCTGGCTGAGG - Intronic
1132899132 16:2243956-2243978 CCCTCCCCTCCACCAGGCTCCGG + Intronic
1133001463 16:2853574-2853596 CCCTGAGCTACAGCTGGCTCTGG + Intronic
1133178232 16:4032368-4032390 TCCTGCCCTCCACCTGCCGCAGG - Intronic
1133186923 16:4106553-4106575 GCCTGTCATCCATCTGGCCCTGG - Intronic
1133234051 16:4379457-4379479 GCGTGCCCTCCAGATGGCCCTGG - Intronic
1133285848 16:4690353-4690375 GGCTGCCCTGCAGCTGGGCCTGG + Exonic
1133524295 16:6589311-6589333 GTCTCCCATACAGCTGGCTCTGG - Intronic
1134552798 16:15145801-15145823 GCCTGCGCTCCAGCTGGCTGAGG - Intergenic
1136107500 16:28040682-28040704 GCCTTCCCTCCACTGGGCTCTGG + Intronic
1136118008 16:28107917-28107939 GCCTGCCTGCCTGCTTGCTCAGG + Intronic
1136534983 16:30893986-30894008 GCCTCCCGTCCGGCGGGCTCAGG + Exonic
1137382150 16:48009453-48009475 CCCTGACCTCCAGTGGGCTCAGG - Intergenic
1137665983 16:50249399-50249421 CACTGCACTCCAGCTTGCTCTGG + Intronic
1138453190 16:57105968-57105990 GCCTGCCCTCCTGCTGGGGTAGG + Intronic
1138495524 16:57406688-57406710 TCCTAGTCTCCAGCTGGCTCAGG - Intronic
1139380393 16:66527050-66527072 GCCTGTCCTCCCTCTGGCTGAGG + Intronic
1140042291 16:71416102-71416124 CCCTGCCCTCCAGCAGGCTCAGG + Intergenic
1140104403 16:71946568-71946590 GCCTACCCTCTAACTGGCTAAGG - Intronic
1140481311 16:75264349-75264371 ACCGGCCCTCCAGCAGGCTCAGG + Exonic
1140486159 16:75295258-75295280 GCCAGCCCTCCAGAAGGGTCAGG - Intronic
1141625326 16:85258545-85258567 GCCTGCCCTCCAGGTGGAGGGGG + Intergenic
1141832566 16:86517866-86517888 TCCTGCCCGCCTGCTGGATCAGG + Intergenic
1142110284 16:88327499-88327521 GCCTGGCCCCTAGCTGGCCCTGG - Intergenic
1142364949 16:89645280-89645302 GCCTGTCCACCAGCAGGCTGCGG - Exonic
1142894085 17:2963486-2963508 ACCTGCCCTGCAGCCTGCTCTGG + Intronic
1142973239 17:3627342-3627364 TCCTCCCCTCCAGCTCGCTCCGG + Intronic
1144788602 17:17845332-17845354 GCCTGGCAACCAGCTGGCGCTGG + Intronic
1145249428 17:21289282-21289304 GCCTGCCCTGCCCCTGGCTTTGG + Intronic
1145888607 17:28399295-28399317 GCCAGCCCTCGTGCTGCCTCTGG + Exonic
1146656478 17:34637944-34637966 CCCTGCCGTGCACCTGGCTCTGG - Exonic
1146890579 17:36503996-36504018 CACAGGCCTCCAGCTGGCTCAGG + Exonic
1147034597 17:37670773-37670795 GCCTGCTCTCCAACTGGCCCTGG - Intergenic
1147586386 17:41655887-41655909 CCCTGCCTTTCTGCTGGCTCTGG + Intergenic
1147870228 17:43581916-43581938 GCCTCCTCTCCAGAGGGCTCAGG - Intergenic
1147931232 17:43982935-43982957 GCCCGGCCTCCAGCTGCCTTTGG - Intronic
1147969677 17:44212661-44212683 GCTTGCACGCCAGCTGGCCCGGG + Intronic
1148221849 17:45868530-45868552 GTCTCCCCCACAGCTGGCTCTGG + Intergenic
1149306773 17:55355562-55355584 GCCTTCACCCCAGCTGCCTCAGG - Intergenic
1149503207 17:57170996-57171018 GCCTCTCCTGCAGCTGGCTCTGG + Intergenic
1150587375 17:66531217-66531239 TCCTGCCCTCCAGCTGTCTCTGG - Intronic
1151454138 17:74215966-74215988 CTCTGCCCTCCAGTTGGCTGGGG + Intronic
1151558004 17:74856404-74856426 GCCTGCCCAGCAGTTGTCTCGGG - Intronic
1152163638 17:78686393-78686415 TCTGGCCTTCCAGCTGGCTCTGG + Intronic
1152571626 17:81123661-81123683 GCCCGCCCTCCAGCTCCCCCAGG - Intronic
1152574841 17:81135439-81135461 GGCTGCCCTCCACTTGGCCCTGG + Intronic
1155803541 18:30138744-30138766 GCCTGCCTTCCAGCTAGGTAAGG - Intergenic
1156539389 18:37894553-37894575 CCCACCCCTCCAGCTGGCTGCGG + Intergenic
1157183334 18:45517229-45517251 GTCTGCCCTGCTGCTGACTCAGG - Intronic
1157672331 18:49540937-49540959 GCCAGCCCTCCAGGTGATTCTGG - Intergenic
1158524224 18:58197882-58197904 GCCTTCCCTCAAGCAGGCTCAGG - Intronic
1160358171 18:78246336-78246358 TCCCAGCCTCCAGCTGGCTCAGG - Intergenic
1161330235 19:3683415-3683437 GCCTGCGCTCCAGCTGTTCCAGG - Intronic
1161729639 19:5951490-5951512 GCATGCTCGCCAGCTGACTCGGG + Exonic
1162514286 19:11138817-11138839 CCCTGCCCTGCAGCTGGCCCTGG + Intronic
1163591451 19:18196373-18196395 CACTGCCATCCACCTGGCTCTGG + Exonic
1164822023 19:31257733-31257755 GCCTGACCTCCTGCCTGCTCTGG + Intergenic
1165153088 19:33772238-33772260 GCTTGCGCTCCTGCTGGCTCCGG - Exonic
1165712870 19:38024537-38024559 CACTGCCCCCCAGCTGGCCCTGG + Intronic
1166748144 19:45151740-45151762 GCCTGCTCTCATGCTGGCACCGG + Exonic
1166809696 19:45507840-45507862 CCCTCCCCCCCAGCTAGCTCCGG + Intronic
1166852209 19:45766362-45766384 GACTGCCCTGCAGCTGCCTTCGG - Exonic
1167864021 19:52309434-52309456 GCCTGCATTACTGCTGGCTCTGG + Intronic
1167940405 19:52942041-52942063 GCCTGCCCTGCACCAGCCTCTGG - Intronic
1168310056 19:55455698-55455720 GCCTGCCCTGCAGCAGGAGCTGG - Exonic
1168444932 19:56403911-56403933 GGCCCCTCTCCAGCTGGCTCAGG + Intronic
1168483832 19:56743759-56743781 GCCTACCCACCAACAGGCTCTGG + Intergenic
925801650 2:7607889-7607911 GCCTGCCCTAAAGGTGGCTCTGG + Intergenic
926122954 2:10254768-10254790 GGGAGCCCTCCAGCTGCCTCTGG - Intergenic
927022841 2:19035390-19035412 GCCTGACCTCCAGCTGGGTTTGG + Intergenic
927969551 2:27296722-27296744 GCCTCCCTTCCAGCTGGGTGTGG - Intronic
928987190 2:37193132-37193154 GCCTCCCATGCAGCTGCCTCTGG - Intronic
929541800 2:42828595-42828617 GCCCACCCTGCAGCTGGCTCAGG - Intergenic
931419194 2:62110358-62110380 GTCTGCCCTTCAGCTGGGTGTGG - Intronic
932131106 2:69187974-69187996 GACTGTCTTCCAGCTGGCTAAGG + Intronic
932275334 2:70447830-70447852 CCCTGCCCTCTAGTTGGTTCTGG - Exonic
932716215 2:74101981-74102003 GCTTGGCCTCCTGCTGGCCCAGG - Exonic
933197329 2:79407102-79407124 CCCTGACCTCCAGCTGCTTCAGG + Intronic
934708810 2:96502430-96502452 GCCTGCCCTGCTGCTGGCCCAGG + Intronic
936518278 2:113196213-113196235 GCCCTTCCTTCAGCTGGCTCAGG + Exonic
937216185 2:120315124-120315146 TCCTGCCCTCCAGCGGCTTCTGG + Intergenic
937267968 2:120629375-120629397 TCCTGCCCTCCAGCTGCCCAGGG + Intergenic
942377332 2:175351448-175351470 GCCTTCCCTCAAGCTGCCTTCGG + Intergenic
946180198 2:217944214-217944236 GGCTGCACTCTAGCTGGCTCTGG + Intronic
946200014 2:218065856-218065878 GGCTGCACTCTAGCCGGCTCTGG + Intronic
948459955 2:238124252-238124274 CCCTGCCCTCCAGTGGGCACTGG - Intronic
948584982 2:239013587-239013609 TCCTGGCCTCCAGCTAGCACAGG - Intergenic
948881105 2:240857576-240857598 GCCTGCCCTGCAGCTTGCTGTGG + Intergenic
1169092199 20:2867718-2867740 GCCTGCACTCCCTCTGGCTGTGG - Intronic
1169189240 20:3646894-3646916 CCCTTCCCTGCAGATGGCTCTGG - Exonic
1169276307 20:4235801-4235823 TCCTACCCTCCAGCGTGCTCAGG + Intronic
1172025432 20:31945281-31945303 GCCTGCCCCACAGATGGCTGTGG + Exonic
1172025557 20:31945917-31945939 GTCGGGCCTCCTGCTGGCTCTGG + Intronic
1172182762 20:33013698-33013720 GCCTGCCCTCCACTTGGCCCAGG - Intronic
1173394600 20:42667756-42667778 TACTGCCCTTCAGCTAGCTCTGG - Intronic
1175108051 20:56628515-56628537 GCCGGCTCTGCAGCTGCCTCTGG - Intergenic
1175259357 20:57664824-57664846 GCCTGCCCTGCAGATGCCTTGGG - Intronic
1176005561 20:62860898-62860920 GCCTGCCCTCCCGGCGGCACAGG - Intronic
1176064413 20:63187299-63187321 GCCTGCCCTCCAGGTCTCTCTGG + Intergenic
1176272706 20:64244758-64244780 CCCTACCCTGCAGCTGCCTCAGG + Intergenic
1177533946 21:22400310-22400332 GCCTGCATTCCAGCTGGGTAAGG + Intergenic
1178137127 21:29640329-29640351 GCCAGTCCTCCAGCAGGCTGAGG + Intronic
1179480949 21:41678304-41678326 GCCTGGCCCCCAGCATGCTCAGG - Intergenic
1179547037 21:42119365-42119387 GGCTGCCCTCTGGCTGCCTCTGG - Intronic
1179711691 21:43267272-43267294 CCCTGGCCTCCTGCTGGCCCTGG + Intergenic
1180558401 22:16596097-16596119 GCCTGAACTCCACCTGGCTCAGG - Intergenic
1180850932 22:19019786-19019808 CCCGGCCCAGCAGCTGGCTCAGG + Intergenic
1181132679 22:20742522-20742544 GCCAGTACTCCAGCTGGCTATGG + Intronic
1182475025 22:30572620-30572642 GCCTTCCCTCCTGCTAGTTCTGG - Intronic
1182770144 22:32789041-32789063 GGCCCCCCTCCAGCTGGCTCCGG + Intronic
1183082473 22:35465332-35465354 GCCTGCTCCCCAGCTGCCTGGGG + Intergenic
1183082859 22:35467985-35468007 GCCAGCTCTCCAGCTGCCTGCGG + Intergenic
1183307342 22:37089700-37089722 ACCTGGCCTCCAGCTGCCTGTGG - Exonic
1183484032 22:38079885-38079907 GCCTGCCCACACACTGGCTCAGG + Intronic
1183619629 22:38964952-38964974 TCCTTCCCTCCAGCTGGCCCAGG + Intronic
1184020788 22:41819926-41819948 GCCTGCTCTCCAGGTCCCTCAGG - Intronic
1184508048 22:44916255-44916277 GAGTGCCCACCAGCAGGCTCCGG - Intronic
1184653106 22:45928199-45928221 CCCTGCCCCCCAGCTTCCTCAGG - Intronic
1184858719 22:47161061-47161083 CCCTGCCTCCCAGCTGGCCCTGG + Intronic
1184989476 22:48157219-48157241 GAGGGCCCTCCAGCTGGGTCTGG + Intergenic
949808017 3:7976664-7976686 GACTCTCCTCCAGCTGCCTCTGG - Intergenic
950428720 3:12938750-12938772 GCCTTCTCACCTGCTGGCTCCGG + Intronic
950480448 3:13240426-13240448 CCCTGCCCTCCACCTAGCCCTGG - Intergenic
951915162 3:27793005-27793027 GACTTCCCTCCCTCTGGCTCAGG - Intergenic
952404326 3:32992149-32992171 CGCTGCCCTCCAGCAGTCTCTGG + Intergenic
952428198 3:33196764-33196786 CCCTGCCTTCCAGTTTGCTCAGG - Intronic
953019636 3:39105255-39105277 GCCTGCCATCCAGCTCCCTCAGG + Intronic
953042534 3:39267892-39267914 GGCTGCCTCCCAGCCGGCTCTGG - Intronic
953458560 3:43063153-43063175 CCCTGCCGTCCAGATGGCTCAGG - Intergenic
953980151 3:47409595-47409617 GGCTGGGCTCCAGGTGGCTCCGG - Intronic
954200644 3:49021485-49021507 GCTTGCCCTTCCGCTTGCTCTGG + Exonic
954287634 3:49630070-49630092 GCCAGGGCTCCAGATGGCTCGGG + Intronic
954420702 3:50417614-50417636 GCATGCCTTCCTCCTGGCTCTGG - Intronic
954447212 3:50553233-50553255 GCCTTCCCTGCCGATGGCTCTGG + Intergenic
955219650 3:57012963-57012985 CCCTGCACTCCTGCTGGCCCTGG + Intronic
955303399 3:57806211-57806233 CCCTGCCCCCCAACTGGCCCTGG + Intronic
955329616 3:58036295-58036317 GCCTCCCACACAGCTGGCTCTGG - Intronic
955495826 3:59531244-59531266 GGCTCCCTTCCAGCTCGCTCTGG - Intergenic
956975290 3:74571992-74572014 ACCTGCCCTCCACCTGCCACTGG + Intergenic
960672531 3:120167108-120167130 GCCAGCCCCCCAGTAGGCTCAGG + Exonic
961210246 3:125120002-125120024 GCCTCCCCTCCAGCTCCCCCAGG - Intronic
961426410 3:126851854-126851876 TCCTGACCTCCAGCTTCCTCAGG - Intronic
961464444 3:127072791-127072813 GCCTGCCCTGAAGCTGGGTGAGG + Intergenic
961657992 3:128453786-128453808 GCCTGCCCTCCATGGGGCTTGGG - Intergenic
962286254 3:134087655-134087677 GCCTGTCCTCCAGATGGCACAGG + Intronic
962447990 3:135485521-135485543 GCTTTCACTCCAACTGGCTCAGG - Intergenic
964791033 3:160453225-160453247 GACTGCTCTCCAGGTGGCTCCGG - Intronic
964830140 3:160874959-160874981 CCCAGCCTTCCAGCTGGCCCAGG + Intronic
968963979 4:3760237-3760259 GCCTGCCTTCCTGCTTGCTTGGG - Intergenic
969635798 4:8369011-8369033 GCGACACCTCCAGCTGGCTCTGG + Intronic
969713062 4:8855463-8855485 GCCTGGCCCCCAGCAGTCTCAGG - Intronic
970280502 4:14449559-14449581 GCCTGCCCTCTGGCTGGCTGTGG - Intergenic
970415958 4:15857133-15857155 CCCAGCTCTGCAGCTGGCTCTGG + Intergenic
971076096 4:23151611-23151633 CCCTGACATCCAGCTGTCTCTGG - Intergenic
973606639 4:52593607-52593629 GCCTGCCCTCCTTCTGGGGCAGG + Exonic
980302159 4:131009416-131009438 GCCTGCTCTCCAGCTAGGTAAGG - Intergenic
980352188 4:131698008-131698030 GGCTGCCCTCCAGCTGGGGAGGG - Intergenic
980792026 4:137632430-137632452 GCATGCTCCCCAGCTGGCGCAGG - Intergenic
982000326 4:151015841-151015863 CCCAGCACTCCGGCTGGCTCGGG - Intergenic
983247843 4:165309105-165309127 GCCTGCCCTCAGGCTGGCACAGG + Intronic
983792444 4:171813946-171813968 GCCCGCCGGCAAGCTGGCTCCGG + Exonic
985569833 5:638937-638959 AGCCGCCCTCCACCTGGCTCAGG + Intronic
985801539 5:2007891-2007913 GGCCTCCCTCCCGCTGGCTCCGG - Intergenic
985894117 5:2739059-2739081 GGCAGCCCTCCAGCGGGTTCTGG + Intergenic
989128854 5:38084057-38084079 GCATGCCCTCCAGATGGCCCAGG - Intergenic
991652805 5:68873465-68873487 GTCTCCCCAGCAGCTGGCTCAGG + Intergenic
992901554 5:81301805-81301827 GCCCGCGCTCCAGCCAGCTCAGG - Exonic
993503833 5:88689354-88689376 GCCTGCCCTGGAGCTAGATCAGG + Intergenic
994431758 5:99674273-99674295 GCATCCCCACCAGCTGGCTGGGG - Intergenic
995524394 5:113038998-113039020 CCCTGCCCTCCAGGAGGCTGCGG - Intronic
998005912 5:138656986-138657008 GCTGTCCCTCCTGCTGGCTCAGG + Intronic
999388620 5:151173931-151173953 GCCTTCCCTACACCTGGGTCAGG - Intergenic
999491542 5:152056233-152056255 TCCTGATTTCCAGCTGGCTCTGG + Intergenic
1000978029 5:167786256-167786278 GGCTGAACTCCAGCTGGCTTTGG + Intronic
1001450508 5:171820889-171820911 GCTTGCCCTCCTCCTGGCCCCGG + Intergenic
1003337279 6:5185909-5185931 GCCTCCCCTTCTGCTGGCCCTGG - Intronic
1003693639 6:8379903-8379925 GCCTTCCCTCCTACTTGCTCTGG - Intergenic
1003753370 6:9087711-9087733 GTCTGCCATCCAGTTGTCTCCGG + Intergenic
1003972427 6:11312137-11312159 GCATTCTCTCCAGCTGGCCCTGG + Intronic
1006641063 6:35490166-35490188 GCCTCCCCTCAAGCAGGCTGTGG + Intronic
1007256860 6:40535632-40535654 TCCTGCCCTCCAGCTGACCCAGG + Intronic
1007414242 6:41682858-41682880 GCCAGCGCCCCGGCTGGCTCAGG + Intergenic
1008009221 6:46445321-46445343 GCCTGCCCACCTGCTGACCCAGG + Intronic
1008552231 6:52644281-52644303 GACTGCCCTCCAGATGGAGCAGG - Intergenic
1008774240 6:55016915-55016937 GCCATCCTTCCAGCTGGCTCAGG + Intergenic
1009059296 6:58378359-58378381 GTCTGCCCTCAAATTGGCTCTGG + Intergenic
1009231551 6:61068766-61068788 GTCTGCCCTCAAATTGGCTCTGG - Intergenic
1009939131 6:70268829-70268851 GCCTGTCCACCAGGTCGCTCAGG - Exonic
1012926718 6:105274817-105274839 GCCTGCCCACCTCCTGGCTGGGG + Intergenic
1013293845 6:108741484-108741506 GCCTGCCCTCCAGTTGTTTGTGG + Intergenic
1017028454 6:150200869-150200891 TCCTGGGCTCCAGCTGGCTGTGG + Intronic
1018054077 6:160036454-160036476 TCCTGGACTCCGGCTGGCTCAGG + Intronic
1019309673 7:353902-353924 GCCTGCCGTCCGGCATGCTCCGG + Intergenic
1019394277 7:808623-808645 GGCTGCCATCCAGATGGCTCGGG + Intergenic
1019712212 7:2522938-2522960 TCCTCCCCTCCTGGTGGCTCAGG + Intronic
1022094702 7:27131148-27131170 GCCTGCCCTACTGCTGGCCTAGG + Intronic
1022481372 7:30745282-30745304 GGTTGCCCTCCAACTGGCTGAGG + Intronic
1023505067 7:40890563-40890585 GCCTGCTCACCTGCTGACTCAGG + Intergenic
1024564734 7:50672160-50672182 GCCTGCCCCCCAGCTCCCTTCGG + Intronic
1025775641 7:64558490-64558512 GCCTCCCCTGCAGATGTCTCAGG + Intronic
1026277056 7:68889209-68889231 TCCTGCCCTGCTGATGGCTCGGG - Intergenic
1029422710 7:100479322-100479344 GGCTTCCCGCCAGCTGGCCCGGG + Intergenic
1029609565 7:101619430-101619452 GGCTGCCTTCCTTCTGGCTCTGG + Intronic
1030688802 7:112511958-112511980 CCCTGCTCTGCGGCTGGCTCTGG + Intergenic
1032191699 7:129769537-129769559 TCCTGGCCTGCAGATGGCTCAGG - Intergenic
1034478546 7:151302763-151302785 GCCGGCTCTCCATCTGCCTCTGG + Intergenic
1034618916 7:152441908-152441930 GCCTGAACTCCACCTGGCTGAGG + Intergenic
1038578660 8:28727835-28727857 GCCTGCACTCCTACAGGCTCCGG + Intronic
1039474911 8:37834574-37834596 GCCTGCTCTACAGCTGAGTCGGG + Intronic
1039895222 8:41712372-41712394 GCCTGCCCTGGACATGGCTCAGG + Intronic
1040637263 8:49289824-49289846 TCCTGCCTTCCAGCAGGCTGTGG + Intergenic
1040792566 8:51250033-51250055 GCCTGCCCCCCAACAGGCCCTGG - Intergenic
1044137680 8:88608359-88608381 GGCTGCCCTGCAGATGGCTGTGG + Intergenic
1045474002 8:102537846-102537868 GTCTGCTCCCCAGGTGGCTCTGG - Intronic
1048436820 8:134425995-134426017 GCCGTCCCTCCAGCTGACTGTGG + Intergenic
1048859274 8:138711840-138711862 GCCTGCCCTGGGGCTGCCTCAGG - Intronic
1049003969 8:139843277-139843299 TGCCGCCCTCCTGCTGGCTCTGG - Intronic
1049227962 8:141466676-141466698 GCCCGCCACCCAGATGGCTCAGG - Intergenic
1049420762 8:142515522-142515544 GCCTGCTCTGAGGCTGGCTCAGG - Intronic
1049427664 8:142544581-142544603 TCCTGTCCTGCATCTGGCTCTGG - Exonic
1049555224 8:143278218-143278240 GCCTGCCTCCCAGCTGACTTCGG - Intergenic
1049693938 8:143974589-143974611 CCCTGCCCTCCGGCTGGAACAGG + Intronic
1049794752 8:144492038-144492060 GCCTGCCCTCCAGCTGGCTCTGG - Intronic
1049794768 8:144492085-144492107 ACCTGCCCTCCGGCTGGTTCTGG - Intronic
1052234159 9:26189358-26189380 GCCTGCCCACCTGCTGACCCAGG + Intergenic
1052867542 9:33473814-33473836 AGCTGCTCTCCAGCTGGCGCCGG + Exonic
1053129982 9:35609304-35609326 GCCAGCGCCCCAGCTGCCTCTGG + Exonic
1053279337 9:36807389-36807411 ACAAGCCCTCCAGGTGGCTCAGG - Intergenic
1053610662 9:39709989-39710011 GCCTCCCCTCCAGGGGGTTCTGG - Intergenic
1053868697 9:42468011-42468033 GCCTCCCCTCCAGGGGGTTCTGG - Intergenic
1054087591 9:60761168-60761190 GCCTCCCCTCCAGGGGGTTCTGG + Intergenic
1054242860 9:62632406-62632428 GCCTCCCCTCCAGGGGGTTCTGG + Intergenic
1054556985 9:66666924-66666946 GCCTCCCCTCCAGGGGGTTCTGG + Intergenic
1055005259 9:71498612-71498634 ACCTGCCCTTGAGCTGGCTGAGG + Intergenic
1055416262 9:76086762-76086784 GCCTAGCCTCTAACTGGCTCTGG + Intronic
1055736594 9:79336961-79336983 GCCTGCTCTCGAGCTGGATAGGG - Intergenic
1057231331 9:93323419-93323441 GCCTGCCTTCCAGGTGGTTAAGG + Intronic
1057236763 9:93367204-93367226 GCCTGCCTTCCAGGTGGTTAAGG - Intergenic
1057550686 9:96049369-96049391 GGCTGGGCTCCGGCTGGCTCAGG - Intergenic
1060023312 9:120150607-120150629 CCCCTCCCTCCATCTGGCTCTGG + Intergenic
1060398586 9:123333799-123333821 ACCTGACCTCCAAGTGGCTCTGG + Intergenic
1060527005 9:124326464-124326486 TCCTGGGCTCCAGGTGGCTCCGG - Intronic
1060829423 9:126704386-126704408 ACCTGTCCTCCAGCTGTCACTGG + Intergenic
1061309048 9:129750558-129750580 GCCTGCACTGCAGCTGGCTCTGG - Intronic
1061505849 9:131031522-131031544 GCCTGGCATGCAGCTGGCCCCGG - Intronic
1061543522 9:131290727-131290749 GCCTCCCTTCAAGCTGCCTCTGG - Intronic
1061679781 9:132237316-132237338 GCCTGCCCTAGAGCTGGCCCAGG + Intronic
1062081583 9:134626803-134626825 GCCTGCCCTCCTGGGGGCCCAGG - Intergenic
1188237497 X:27747852-27747874 ACCTGCCCACAAGTTGGCTCTGG + Exonic
1188257460 X:27980452-27980474 ACCTGCCCACGAGTTGGCTCTGG - Exonic
1189850122 X:45169506-45169528 ACCTCTCCTCCAGCTGGCCCAGG + Intronic
1191721082 X:64229344-64229366 CCATGCTCTCCAGCTGGCTGTGG + Intronic
1192169589 X:68845995-68846017 GGCTGCCCTCATGCTGGTTCAGG + Intergenic
1192847876 X:74924821-74924843 GCCGGCTCCCCGGCTGGCTCGGG - Intronic
1198073840 X:133176106-133176128 TCCTGCCCTCCAGGTCTCTCTGG - Intergenic
1200212495 X:154352969-154352991 GGCTGCCCACCAGCTGGGGCGGG - Intronic
1200234414 X:154461401-154461423 GCCTGGCCTGCTGCTGGCCCAGG + Exonic