ID: 1049794753

View in Genome Browser
Species Human (GRCh38)
Location 8:144492044-144492066
Sequence CACATTGCCTGCCCTCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 6, 3: 27, 4: 304}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049794753_1049794775 28 Left 1049794753 8:144492044-144492066 CCAGCTGGAGGGCAGGCAATGTG 0: 1
1: 0
2: 6
3: 27
4: 304
Right 1049794775 8:144492095-144492117 CCGGAGGGCAGGTGGTGTGGGGG No data
1049794753_1049794761 9 Left 1049794753 8:144492044-144492066 CCAGCTGGAGGGCAGGCAATGTG 0: 1
1: 0
2: 6
3: 27
4: 304
Right 1049794761 8:144492076-144492098 GGCTGGCCCCCAGAACCAGCCGG No data
1049794753_1049794771 25 Left 1049794753 8:144492044-144492066 CCAGCTGGAGGGCAGGCAATGTG 0: 1
1: 0
2: 6
3: 27
4: 304
Right 1049794771 8:144492092-144492114 CAGCCGGAGGGCAGGTGGTGTGG No data
1049794753_1049794763 13 Left 1049794753 8:144492044-144492066 CCAGCTGGAGGGCAGGCAATGTG 0: 1
1: 0
2: 6
3: 27
4: 304
Right 1049794763 8:144492080-144492102 GGCCCCCAGAACCAGCCGGAGGG No data
1049794753_1049794772 26 Left 1049794753 8:144492044-144492066 CCAGCTGGAGGGCAGGCAATGTG 0: 1
1: 0
2: 6
3: 27
4: 304
Right 1049794772 8:144492093-144492115 AGCCGGAGGGCAGGTGGTGTGGG No data
1049794753_1049794762 12 Left 1049794753 8:144492044-144492066 CCAGCTGGAGGGCAGGCAATGTG 0: 1
1: 0
2: 6
3: 27
4: 304
Right 1049794762 8:144492079-144492101 TGGCCCCCAGAACCAGCCGGAGG No data
1049794753_1049794769 20 Left 1049794753 8:144492044-144492066 CCAGCTGGAGGGCAGGCAATGTG 0: 1
1: 0
2: 6
3: 27
4: 304
Right 1049794769 8:144492087-144492109 AGAACCAGCCGGAGGGCAGGTGG No data
1049794753_1049794767 17 Left 1049794753 8:144492044-144492066 CCAGCTGGAGGGCAGGCAATGTG 0: 1
1: 0
2: 6
3: 27
4: 304
Right 1049794767 8:144492084-144492106 CCCAGAACCAGCCGGAGGGCAGG No data
1049794753_1049794760 -8 Left 1049794753 8:144492044-144492066 CCAGCTGGAGGGCAGGCAATGTG 0: 1
1: 0
2: 6
3: 27
4: 304
Right 1049794760 8:144492059-144492081 GCAATGTGGGGGCGCTGGGCTGG No data
1049794753_1049794773 27 Left 1049794753 8:144492044-144492066 CCAGCTGGAGGGCAGGCAATGTG 0: 1
1: 0
2: 6
3: 27
4: 304
Right 1049794773 8:144492094-144492116 GCCGGAGGGCAGGTGGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049794753 Original CRISPR CACATTGCCTGCCCTCCAGC TGG (reversed) Intronic
900603898 1:3515405-3515427 CACAATGCCTGCCGTCCTCCTGG + Exonic
901026843 1:6282847-6282869 CCCATGGCCTGCCCTCCTCCCGG - Intronic
901208512 1:7511110-7511132 CACAGTTCCTGCCTTCCAGGAGG - Intronic
901468725 1:9440875-9440897 CACATGCCCTTCCCTCCAGCAGG + Intergenic
901810150 1:11762762-11762784 AACAATGCCTGACCCCCAGCAGG - Intronic
902070171 1:13727713-13727735 AACATTGCCTGGCCTGTAGCAGG + Intronic
902479189 1:16702664-16702686 CCCACTGCCTGCCTCCCAGCAGG - Intergenic
902843147 1:19088146-19088168 CACCTTGCCAGGGCTCCAGCTGG - Intronic
902887087 1:19413247-19413269 CACAGTGCCTGACTTCCAGGAGG + Intronic
903264998 1:22152846-22152868 CACAGTCCCTGCCCTCCTGGAGG - Intergenic
904085535 1:27904451-27904473 CACAGTCCCTGCCATCAAGCAGG - Intronic
904203052 1:28834279-28834301 CACAGTTCCTGCCCTCCAGGAGG - Intronic
904291952 1:29492163-29492185 CACATTGGCTCCAGTCCAGCAGG - Intergenic
904546307 1:31275676-31275698 CACAGTGCCTGGCCATCAGCAGG + Intronic
905880906 1:41463249-41463271 CACTGTGCCTGTCCTCCATCAGG + Intergenic
906070834 1:43015288-43015310 TCCTCTGCCTGCCCTCCAGCAGG + Intergenic
907640469 1:56184065-56184087 GACGATGCCTGCCCTCCTGCTGG - Intergenic
908570632 1:65406394-65406416 CACAGTCCCTGCCCTCCATCTGG - Intronic
909481510 1:76132328-76132350 CAGCTTGCCTTCCCTCCAGTGGG + Intronic
916219474 1:162429165-162429187 CACAGTGCCCGGCCTACAGCAGG + Intergenic
916775700 1:167961527-167961549 CACTGTGCCTGGCCTCCAGGAGG + Intronic
918223030 1:182453485-182453507 CACATGGCCTTCTCTCCATCTGG - Intronic
918315097 1:183316641-183316663 CACAGTGCCTGCCCTCCAGAGGG - Intronic
919161218 1:193833326-193833348 CACTGTGCCCGGCCTCCAGCAGG + Intergenic
920686521 1:208113215-208113237 CACATTGACTGCCCTACCCCAGG + Intronic
920940873 1:210481012-210481034 CACATAGCTTACTCTCCAGCTGG + Intronic
921158076 1:212453478-212453500 CAGCTTCCCTGCCCTCCAGCCGG + Intergenic
923233254 1:232008302-232008324 AACATTCCCTGCCTTCCAACTGG - Intronic
1062967928 10:1624457-1624479 CACCTTGCCTCCCCACCGGCTGG + Intronic
1064939377 10:20715369-20715391 CACAGTGCCTTCCCTACTGCAGG + Intergenic
1064980267 10:21159651-21159673 CACATGGTCTGCCATGCAGCGGG + Intronic
1067335092 10:45354867-45354889 CACATTTCCTTCCCTTCATCTGG - Intergenic
1069072055 10:63998969-63998991 CAGATTGCCTGCCTCCCTGCAGG - Intergenic
1069615680 10:69804706-69804728 CACAATGCCTGACCCGCAGCAGG - Intronic
1069798713 10:71069333-71069355 GACAGTGCCTGCCCTGCTGCTGG + Intergenic
1070453086 10:76581470-76581492 CAAACTGCATGCACTCCAGCTGG + Intergenic
1070700422 10:78597949-78597971 CACCTTGCCTGGCCTCCCTCTGG + Intergenic
1071133635 10:82426675-82426697 CACATCCACTGCTCTCCAGCTGG - Intronic
1071516888 10:86304007-86304029 ATCATTTCCTCCCCTCCAGCTGG + Intronic
1072299145 10:94042014-94042036 CACAGTGCCTGACATACAGCAGG - Intronic
1074424948 10:113342513-113342535 AACATTGCCTTCCCTTCAACTGG + Intergenic
1075074046 10:119338637-119338659 CTCATGGGCTGCCCTCCTGCAGG + Intronic
1075479564 10:122768265-122768287 CACACTGCATGTCATCCAGCAGG - Intergenic
1077552073 11:3204934-3204956 AACACTGCCTGCCATCCACCCGG + Intergenic
1079357257 11:19740029-19740051 CCCAGTGGCTGCCCTCCAGGGGG - Intronic
1080890455 11:36404552-36404574 CACTGTGCCTGGCCTCCATCAGG + Intronic
1081393867 11:42561939-42561961 CACAATGCCTGGCCTAAAGCTGG + Intergenic
1081692817 11:45089563-45089585 CCTACTCCCTGCCCTCCAGCAGG + Intergenic
1082005697 11:47417930-47417952 CGCACTGTCTGCCATCCAGCAGG - Intergenic
1083518026 11:63278771-63278793 CACATGGTCTGCCATCCAGGCGG + Intronic
1083852702 11:65377325-65377347 CAACTTGCCTGGCCTACAGCAGG + Intronic
1084727093 11:70949018-70949040 CTCACTGCCTGCCCTGCAGGAGG + Intronic
1085305148 11:75481654-75481676 CACATTCCCAGCCTTCCCGCAGG + Intronic
1086169109 11:83815550-83815572 CATAGTGCCTACGCTCCAGCTGG + Intronic
1086943607 11:92823125-92823147 CCCAGTGCCTGCCATGCAGCAGG + Intronic
1089538958 11:119178351-119178373 CACATTGCCTGGCACACAGCAGG - Intronic
1089835373 11:121365784-121365806 CCCAATGCCTGCCATCCAGTAGG + Intergenic
1090230806 11:125102227-125102249 CACAGTGCCAGCCATCCCGCGGG + Exonic
1090414366 11:126530538-126530560 CACAGTGCCTGCCTCACAGCAGG - Intronic
1090648831 11:128788888-128788910 CACACTACCTACCCTCAAGCAGG + Intronic
1090766235 11:129878672-129878694 CACATCCACTGCCTTCCAGCTGG + Intronic
1091005953 11:131953983-131954005 CACCTTGCCTGCCTTACAGATGG - Intronic
1091349199 11:134879530-134879552 CACTTGGCCTGACTTCCAGCAGG - Intergenic
1092609139 12:10153687-10153709 TTCATGGCCTGCGCTCCAGCGGG - Intergenic
1093139265 12:15488847-15488869 TATATTGCCTGCCCTTCAGAGGG + Intronic
1093999946 12:25684185-25684207 CTCGCTGCCTGCCCTCCATCAGG + Intergenic
1094035193 12:26062811-26062833 CACACTGCCTGGCCCACAGCAGG - Intronic
1094101491 12:26769134-26769156 AACCTTGCTTGCCCTTCAGCTGG - Intronic
1094291355 12:28853712-28853734 TACATTGCCTGCCCTCATACAGG - Intergenic
1097258732 12:57700528-57700550 CACAGTGCCTGCCCTGGAGTAGG - Intronic
1098600940 12:72331066-72331088 CAAATTGCCTGGCATACAGCAGG - Intronic
1100297850 12:93279158-93279180 CACAGTGCCTGGCATACAGCAGG - Intergenic
1101866533 12:108524563-108524585 CCCAGTGCCTGCCCTGCAGGAGG - Intronic
1101984369 12:109433946-109433968 CACATTGCCTGCCCGACCCCAGG - Intronic
1102074662 12:110050266-110050288 CACATTGCCTCACCTCCTGAAGG + Intronic
1102405289 12:112668213-112668235 CACAATGCCTGTCCTACAGGTGG + Intronic
1103085081 12:118056534-118056556 CTCACTGCCTGCCCTCCACCAGG - Intronic
1103528429 12:121582736-121582758 CAGAATGCCTGCCCTGCTGCCGG + Intergenic
1104473951 12:129055000-129055022 CTCCCTGCCTCCCCTCCAGCTGG + Intergenic
1105103602 13:16495598-16495620 AACATTGCCTTTCCTACAGCAGG + Intergenic
1107087147 13:36437662-36437684 GAAAATGCCTTCCCTCCAGCTGG + Exonic
1109212933 13:59555652-59555674 CACCATGCCTGGCCTACAGCTGG + Intergenic
1110315531 13:74101929-74101951 CACTGTGCCTGGCCTCCATCAGG - Intronic
1114084224 14:19227695-19227717 TACCTTCCCTGCCCTCCAGTTGG + Intergenic
1114498995 14:23154313-23154335 CAGACTCCCTCCCCTCCAGCTGG + Intronic
1118063836 14:62168935-62168957 CGGATTGCCTGCCCACCTGCTGG - Intergenic
1118492141 14:66271599-66271621 CATCTTGCTTGGCCTCCAGCAGG - Intergenic
1121241370 14:92432275-92432297 CATATCACCTGACCTCCAGCAGG - Intronic
1121504515 14:94466365-94466387 CACCTTTCCTGCCCTCCCGTGGG + Intronic
1121740771 14:96250904-96250926 CATATCCCCTACCCTCCAGCAGG - Intronic
1122272031 14:100572579-100572601 CTCATTTCCTCCCCTCCAGGAGG - Intronic
1122539620 14:102490678-102490700 CACTTTGCCAGTCCTTCAGCAGG + Intronic
1123043862 14:105501963-105501985 CACATTCCCTGGGCTCCAGGGGG - Intergenic
1202895837 14_GL000194v1_random:9552-9574 TACCTTCCCTGCCCTCCAGTTGG + Intergenic
1124205287 15:27713493-27713515 CACATTGCCTGGCATGCAGCAGG - Intergenic
1124254244 15:28128232-28128254 CACATTGCCTGCCAGTCAGCTGG - Intronic
1124370894 15:29104047-29104069 CAGGCGGCCTGCCCTCCAGCAGG - Intronic
1127501564 15:59558567-59558589 CACATTTCCTGTTCTTCAGCAGG + Intergenic
1129947279 15:79550020-79550042 CACACAGCCTGACCTGCAGCAGG - Intergenic
1131087112 15:89586425-89586447 AACAGTGCCTGCCATACAGCAGG - Intronic
1131460925 15:92616982-92617004 CCCATTTGCTGCCGTCCAGCTGG - Intergenic
1132941241 16:2509348-2509370 CTCAGTGCCTGCTGTCCAGCGGG + Intronic
1134626494 16:15726301-15726323 CACAGTGCCTGGCATACAGCAGG + Exonic
1135424702 16:22326516-22326538 CCTATTGCCTGGCCTGCAGCAGG + Intronic
1139471788 16:67181960-67181982 CACCCTGCCTGGCCTCCAGGAGG - Intronic
1139596532 16:67961572-67961594 CACCTCGGCTGCCCTCCGGCGGG + Exonic
1140317272 16:73911306-73911328 CACATTGACTGCACTCTACCTGG - Intergenic
1141291546 16:82722543-82722565 CACATGGCCAGCTCTGCAGCTGG + Intronic
1141680948 16:85543516-85543538 CCCAGGGCCTGCCCCCCAGCAGG - Intergenic
1142856601 17:2734046-2734068 CACCGTGCCTGGCCTCCAGCTGG + Intergenic
1147194260 17:38754818-38754840 CTCATTGCTTTTCCTCCAGCAGG + Intronic
1147270024 17:39262610-39262632 CACACTGCCTTTCCTACAGCAGG + Intronic
1147312109 17:39601549-39601571 CACATTCCCTGCACTCTGGCTGG - Intergenic
1147459036 17:40556936-40556958 CACGTTGCCTGAGCTCCTGCTGG - Intronic
1147895005 17:43744830-43744852 CACAGAGCCTGGCCTGCAGCAGG - Intergenic
1150493506 17:65590437-65590459 CACATTACCTGCCCTTCTTCAGG + Intronic
1151485078 17:74394008-74394030 CACACTGCCTGCCCACCACCTGG + Intergenic
1152073459 17:78145346-78145368 CACACTGCCTGCGATGCAGCTGG + Intergenic
1152108666 17:78344899-78344921 CAGATGGCCTGGCCACCAGCAGG - Intergenic
1152181433 17:78824168-78824190 CTCATTGCCCACCCTCCAGTTGG - Intronic
1153736486 18:8074505-8074527 GACTTTACCTTCCCTCCAGCAGG + Intronic
1155198965 18:23501177-23501199 CACAGTGCCATCCCTGCAGCTGG - Intergenic
1155504941 18:26524173-26524195 CACATTGCCTGCTTTCCAGCAGG + Intronic
1155910861 18:31503123-31503145 CACATTGCCTAGCATCAAGCAGG - Intronic
1157189652 18:45570102-45570124 CACATTGCTCCCTCTCCAGCTGG - Intronic
1157956132 18:52099591-52099613 CACATGGCATTCCCTCCACCAGG - Intergenic
1159315727 18:66771052-66771074 CACTTTGCCTGGTGTCCAGCAGG - Intergenic
1160051960 18:75442151-75442173 CACATTGCTTGCCCTGCTGCTGG - Intergenic
1160693454 19:470948-470970 CCCCATGCCTGCCCTCCCGCAGG + Intronic
1161309003 19:3583667-3583689 CACAGTGCCTGGCATACAGCAGG - Intergenic
1161938476 19:7386907-7386929 GACAGTTCCTGCCTTCCAGCTGG + Intronic
1162231876 19:9273804-9273826 CACATTGCCTGGCCTCCCTAAGG - Intergenic
1163578634 19:18124815-18124837 CACCGTGCCTGGCCTCCATCCGG - Intronic
1163797324 19:19345159-19345181 CATATTACCTGCCTTGCAGCTGG + Intronic
1164476140 19:28577430-28577452 AACATTGCTTACCCTGCAGCTGG - Intergenic
1164860053 19:31555582-31555604 CACAGTGCCTGACTCCCAGCAGG + Intergenic
1165394140 19:35555131-35555153 CACACTGCCTGCCCTCCCCCTGG + Intronic
1166369688 19:42293916-42293938 GACCCTGCCGGCCCTCCAGCAGG + Exonic
1167498214 19:49831322-49831344 CACAGTGCCTGCCTGCCAGAGGG - Exonic
1167820481 19:51923022-51923044 CACTGTGCCTGGCCTCCAGGAGG + Intronic
1168310057 19:55455704-55455726 CATGGTGCCTGCCCTGCAGCAGG - Exonic
1202713228 1_KI270714v1_random:28570-28592 CCCACTGCCTGCCTCCCAGCAGG - Intergenic
925284738 2:2708560-2708582 CACAATGCCTGCCCTCAGGGGGG + Intergenic
925352176 2:3209053-3209075 CACCCTGCCTTCCCACCAGCAGG - Intronic
925745171 2:7037994-7038016 CACAGAGCCTGCTTTCCAGCCGG - Intronic
925788199 2:7453424-7453446 CACAGTGCCTGGCCTGTAGCAGG - Intergenic
926304387 2:11627591-11627613 CACATTGCCTGGCATGCAGTAGG - Intronic
926340977 2:11904144-11904166 CACAGTGCCTGACATACAGCTGG + Intergenic
927022839 2:19035384-19035406 CATGTCGCCTGACCTCCAGCTGG + Intergenic
927150262 2:20191512-20191534 CACAATCCCTGCCCGCCAGGGGG - Intergenic
927494486 2:23543428-23543450 CACAGTGCCTGACCCCCAGTAGG + Intronic
929168598 2:38908152-38908174 CACCGTGCCTGGCCTCCAGGAGG + Intronic
929555933 2:42925663-42925685 CACATTTGCTCCCCTCCTGCTGG - Intergenic
929836151 2:45401926-45401948 TTCATTGCCTTCCCTCCAACCGG - Intronic
930603935 2:53473055-53473077 CACATTGACTAACCTCCTGCTGG + Intergenic
932120229 2:69091986-69092008 CACAGTGCCTGGCATGCAGCAGG - Intronic
932846632 2:75142111-75142133 CTCACTGCCTCCCCTCCAGTTGG - Intronic
933632207 2:84671462-84671484 CACATTGCCCACCATCCAGCAGG + Intronic
933649675 2:84840504-84840526 CACATTCCCTGACCTCCTGTAGG + Intronic
936152758 2:110030709-110030731 CGCATGGCCTGCCCTCGATCTGG + Intergenic
936191922 2:110340703-110340725 CGCATGGCCTGCCCTCGATCTGG - Intergenic
937280489 2:120714193-120714215 CACTCTGCCTGCACACCAGCTGG - Intergenic
937530092 2:122817684-122817706 CACATGCCCTGCCCTCAAGAAGG - Intergenic
938137959 2:128774777-128774799 CACCTTGGCTGCACTCCAGAAGG - Intergenic
938192918 2:129299714-129299736 CACAGTGCCTGTCCTGCATCAGG - Intergenic
938248894 2:129798683-129798705 CCCACTGCCTGGCCTGCAGCTGG - Intergenic
938492362 2:131768393-131768415 TACCTTCCCTGCCCTCCAGTTGG - Intergenic
938495207 2:131793957-131793979 TACCTTCCCTGCCCTCCAGTTGG + Intergenic
938683003 2:133711382-133711404 CACATTGCTTCCCCTGCAGCTGG - Intergenic
939088443 2:137749986-137750008 TAGATTGACTGCCCTCAAGCAGG + Intergenic
942405745 2:175652633-175652655 CACATTACCTGACTTCAAGCTGG + Intergenic
943530375 2:189072481-189072503 CACCGTGCCTGGCCTCCAGATGG - Intronic
944672546 2:202007119-202007141 CACCATGCCTGCCCTCCAGGCGG - Intergenic
945489107 2:210434041-210434063 AAAATTGTCTGCCCTCCAGTTGG + Exonic
947177192 2:227379968-227379990 CACATTGCCTCTCCACTAGCTGG + Intronic
947536792 2:230944820-230944842 CCCATTGCCTGCCCTCATGCTGG + Intronic
948780772 2:240320293-240320315 AACGTTTCCTGCCCTCCCGCTGG - Intergenic
949077940 2:242073293-242073315 CACACTGCCCACCCTGCAGCAGG - Intergenic
1169273795 20:4219795-4219817 CACATTGGCTGCCCCAAAGCTGG - Intergenic
1169418820 20:5442763-5442785 CACAGACCCTGCCCTCCAGGAGG + Intergenic
1171986014 20:31661795-31661817 CTCCAGGCCTGCCCTCCAGCTGG + Intergenic
1173384680 20:42576389-42576411 CACGGTGCCTGGCCTGCAGCTGG + Intronic
1174107798 20:48175359-48175381 CCCACTGCCTGCCCTTCTGCTGG + Intergenic
1174699494 20:52593662-52593684 CACATTGCATGCTCTGCAGGTGG + Intergenic
1175048271 20:56127768-56127790 CACATTGCCTGCCCCACTGGCGG - Intergenic
1175300905 20:57942121-57942143 CACACTGCCTCCCCTGCAGTGGG - Intergenic
1176615526 21:9025612-9025634 TACCTTCCCTGCCCTCCAGTTGG + Intergenic
1176709654 21:10138194-10138216 TACCTTCCCTGCCCTCCAGTTGG - Intergenic
1178077971 21:29030206-29030228 CACAGTGCCTGCCCTATAGTAGG + Intronic
1178089137 21:29143216-29143238 CACAGAGCCCGCCCTCCAGACGG - Intronic
1178137126 21:29640323-29640345 CTCAGTGCCAGTCCTCCAGCAGG + Intronic
1178330121 21:31682540-31682562 CTAAGTGCCTGCCCTACAGCAGG + Intronic
1178762281 21:35414684-35414706 CTCATTGCCTACCCTCCCCCTGG + Intronic
1180085077 21:45504771-45504793 TCCATGGCCTGCCCTCCTGCTGG + Intronic
1180293748 22:10865508-10865530 TACCTTCCCTGCCCTCCAGTTGG - Intergenic
1180496553 22:15894923-15894945 TACCTTCCCTGCCCTCCAGTTGG - Intergenic
1181458710 22:23073771-23073793 CACAGTGCCTGGCATGCAGCAGG - Intronic
1182732812 22:32508793-32508815 CACATTGCTTGGCACCCAGCAGG - Intergenic
1183382122 22:37495538-37495560 AGAAATGCCTGCCCTCCAGCCGG - Exonic
1184383667 22:44162017-44162039 GACATGGCCTGCCCTCCTGCCGG + Intronic
1184512604 22:44942281-44942303 CCCATCGGCTGCCCTCCAGATGG - Intronic
950639508 3:14339790-14339812 CGCATTGCATGCACTCCAGCTGG - Intergenic
953054065 3:39373465-39373487 CCCACTGCCTGGCCTACAGCAGG + Intergenic
954465094 3:50649593-50649615 CACTCTGCCCGCCCTTCAGCAGG - Intergenic
956628584 3:71291507-71291529 CACAATGCCTGGCATACAGCAGG + Intronic
956783175 3:72620594-72620616 AACATTCCCTGCACTCCAGATGG + Intergenic
957933681 3:86914843-86914865 CACATGGCCAGCCTTACAGCTGG - Intergenic
958269173 3:91477457-91477479 GACATAACCTCCCCTCCAGCTGG + Intergenic
959810925 3:110618336-110618358 CACGTTGCTTCCCCTTCAGCAGG + Intergenic
961574674 3:127824544-127824566 CCCACTGTCTGGCCTCCAGCAGG + Intergenic
961592411 3:127990721-127990743 CACATTTCCTCTCCTCCAGAAGG - Intergenic
961721834 3:128902450-128902472 CAGCTTGCCTTCCCTCAAGCTGG - Intronic
962702642 3:138014296-138014318 CACATTTGCTGTCCTCCAGCTGG - Intronic
963150829 3:142043970-142043992 CACTGTGCCTGCCTTCCGGCGGG + Intronic
963757090 3:149246224-149246246 CACAATGCCTGGCATACAGCAGG + Intergenic
963940570 3:151092346-151092368 TCCATGGCCTGCCTTCCAGCTGG + Intronic
966498009 3:180602408-180602430 CTCATTACCTGCCCTGCAACGGG - Exonic
967200798 3:187070827-187070849 CACAGTCCCTGCCCTCCAGGAGG - Intronic
967612258 3:191521382-191521404 CACATTGCCTGCTCTACAACAGG + Intergenic
969277990 4:6149906-6149928 CCCATGGCCCACCCTCCAGCTGG + Intronic
970110624 4:12633831-12633853 CACAGTGTCTGCCCCACAGCAGG + Intergenic
970574190 4:17411670-17411692 CCCATTGCATGCCCTGCAACGGG - Intergenic
974294275 4:59975628-59975650 CAAAACACCTGCCCTCCAGCAGG - Intergenic
975892939 4:79050712-79050734 ACCATTGCCGGCGCTCCAGCTGG + Intergenic
977574737 4:98663813-98663835 AACATTGCCTGCACTTCAGCTGG - Intergenic
977917924 4:102614224-102614246 CACATTGGCAGCCTTCCATCCGG + Intronic
979856530 4:125639567-125639589 CACCTTACCTGCCCTCAAACAGG + Intergenic
981500284 4:145442701-145442723 CCCACTCCCTGCCCTCCAGTAGG - Intergenic
982227907 4:153182570-153182592 CACAGTGCCTGCCCTGCAGCAGG + Intronic
982262639 4:153508500-153508522 CACATTGCCTGGCACCCAGCAGG - Intronic
982743131 4:159078827-159078849 CACCATGCCTGGCCTCCAGTTGG - Intergenic
983247842 4:165309099-165309121 CACATTGCCTGCCCTCAGGCTGG + Intronic
987000660 5:13656101-13656123 CACCTCCCCTGCCCTCCAGTGGG + Intergenic
987709785 5:21492406-21492428 CATCTGGCCTGCCCTACAGCAGG - Intergenic
988749828 5:34181757-34181779 CATCTGGCCTGCCCTACAGCAGG + Intergenic
988908711 5:35817471-35817493 CACATTGCCTCCCTTCGAGATGG + Intergenic
990566222 5:57032113-57032135 CACAATGCCTGCCATCCTGAAGG - Intergenic
991738087 5:69644961-69644983 CATCTGGCCTGCCCTACAGCAGG + Intergenic
991760107 5:69911463-69911485 CATCTGGCCTGCCCTACAGCAGG - Intergenic
991787225 5:70206637-70206659 CATCTGGCCTGCCCTACAGCAGG + Intergenic
991789663 5:70224687-70224709 CATCTGGCCTGCCCTACAGCAGG + Intergenic
991814412 5:70499797-70499819 CATCTGGCCTGCCCTACAGCAGG + Intergenic
991817547 5:70521089-70521111 CATCTGGCCTGCCCTACAGCAGG + Intergenic
991839338 5:70786514-70786536 CATCTGGCCTGCCCTACAGCAGG - Intergenic
991879671 5:71207027-71207049 CATCTGGCCTGCCCTACAGCAGG + Intergenic
991882111 5:71225056-71225078 CATCTGGCCTGCCCTACAGCAGG + Intergenic
992000269 5:72429515-72429537 CACAGTGCCTGCCATGTAGCAGG + Intergenic
992077444 5:73204238-73204260 CACAATGCCTGGCCTCCAAGAGG + Intergenic
994032702 5:95163221-95163243 CATAGTGCCTGCCTCCCAGCAGG + Intronic
994214518 5:97122743-97122765 CACATTGCCTATTGTCCAGCGGG - Intronic
994421905 5:99533725-99533747 CATCTGGCCTGCCCTACAGCAGG - Intergenic
994460937 5:100066856-100066878 CATCTGGCCTGCCCTACAGCAGG + Intergenic
994485084 5:100380284-100380306 CATCTGGCCTGCCCTACAGCAGG + Intergenic
994949817 5:106446992-106447014 CACCGTGCCTGGCCTCTAGCAGG + Intergenic
996577996 5:124997902-124997924 CACACTGCCTGCATTCCATCTGG - Intergenic
997176360 5:131782258-131782280 CACAGTGCCTGGCCTCCAGAAGG - Intronic
997263325 5:132480157-132480179 CTCACTGCCTACCCTCCATCAGG + Intergenic
1000022258 5:157328230-157328252 CACACAGCCTGCAGTCCAGCAGG + Intronic
1001571360 5:172732581-172732603 CACAAGCCCTGCTCTCCAGCTGG + Intergenic
1001615845 5:173042903-173042925 CAGCTTGGCTGCCCTTCAGCTGG + Intergenic
1002061023 5:176626246-176626268 CACTTTGCCTCCCATCCTGCAGG - Intronic
1002458134 5:179357670-179357692 CACAGGGCTTGCACTCCAGCAGG + Intergenic
1002535260 5:179872390-179872412 CACATTCCCAGCCCTCCTGCAGG - Intronic
1003646357 6:7915815-7915837 AAAATTCCCTGACCTCCAGCTGG + Intronic
1005125585 6:22443106-22443128 CACGTGGCTTGCCTTCCAGCAGG - Intergenic
1005547894 6:26888100-26888122 CATCTGGCCTGCCCTACAGCAGG + Intergenic
1006205434 6:32337403-32337425 GCCATTGCCTGTCTTCCAGCTGG + Intronic
1007166954 6:39835513-39835535 CACAGTCCCTGCCCTCCTGCAGG - Intronic
1007253851 6:40514988-40515010 CAGACTGCCTGGCCTGCAGCAGG + Intronic
1007779678 6:44245846-44245868 CGTTTTGCCTGCCCTCCAGTTGG - Intergenic
1009018655 6:57929181-57929203 CATCTGGCCTGCCCTACAGCAGG + Intergenic
1014021818 6:116599540-116599562 CACAGCTCCTGCCCTCCAACTGG - Intergenic
1017452768 6:154569655-154569677 CACATGACCTGACTTCCAGCGGG + Intergenic
1019293598 7:262220-262242 CACACTTCCAGCCCTGCAGCAGG - Intergenic
1020148380 7:5662776-5662798 CACACTGCCTGCCCCCTACCTGG - Intronic
1020474799 7:8582399-8582421 CACCTTGCTCGCCCTCCAGTTGG - Intronic
1022480397 7:30739791-30739813 CACATTGCCTGCCCTCCTCCAGG - Intronic
1023048505 7:36231615-36231637 CACAGTTCCTGCCCTCCACAAGG - Intronic
1024039184 7:45536559-45536581 AACATTCCCAGCACTCCAGCTGG - Intergenic
1025092711 7:56076931-56076953 CACAGTGCCCAGCCTCCAGCAGG - Intronic
1025928115 7:65975120-65975142 CATCCGGCCTGCCCTCCAGCAGG + Intronic
1026898012 7:74021762-74021784 CTGATTGCCTCCCCTCCTGCAGG + Intergenic
1027359844 7:77396439-77396461 CATAATGCCTGACCCCCAGCAGG + Intronic
1028767930 7:94581527-94581549 CCCATCTCCTGCCCTCCAACAGG + Intergenic
1029251672 7:99241292-99241314 CACCATGCCTGGCCTCAAGCTGG - Intergenic
1032844201 7:135738753-135738775 CACAGTGCCTGCTCCCCAGAGGG - Intronic
1033425905 7:141243936-141243958 CACAATGCCTGCCCTCATGACGG + Intronic
1033610869 7:142962112-142962134 TACATTCCCTCCCCTCCAGTGGG + Intronic
1034105220 7:148484041-148484063 CACAGTGCCGTCCCCCCAGCAGG - Intergenic
1034120636 7:148624004-148624026 GACATTACATGCCCTCCAGTGGG + Intergenic
1034266445 7:149783377-149783399 CACCTGCCCTGCCCTCCACCTGG + Intergenic
1034285391 7:149880366-149880388 CACCTTGCCTGGCTCCCAGCTGG + Exonic
1034939333 7:155220310-155220332 AACATGCCCTGCCCTCCTGCCGG + Intergenic
1035159108 7:156938241-156938263 CACCTTACCTGCCCTCTGGCTGG - Intergenic
1035536479 8:395094-395116 CACACTGCCCACCCTGCAGCAGG - Intergenic
1035624228 8:1059542-1059564 CCCATTGCCTCCCCTCCATTAGG + Intergenic
1036198333 8:6743590-6743612 CACAGTGCCTGCACTTCTGCAGG - Intronic
1038270002 8:26067405-26067427 CTCACTGCCAGCCTTCCAGCAGG + Intergenic
1038785515 8:30611157-30611179 AACCTTGTCTGCCCTACAGCAGG - Intronic
1040402327 8:47063732-47063754 CACAATTCCTGTCCTCCAGATGG - Intergenic
1045996776 8:108372130-108372152 CAAATTGCATGCCCTATAGCGGG + Intronic
1046110885 8:109722755-109722777 CACACTCCCTGCCCTGCAGAAGG + Intergenic
1048336952 8:133509729-133509751 TACATTCACTGCCCTCCAGAGGG - Intronic
1049058836 8:140259820-140259842 CACAGGGCCTGGCCACCAGCAGG + Intronic
1049368903 8:142254142-142254164 CACACTGCCAGGCTTCCAGCCGG - Intronic
1049395005 8:142395947-142395969 CACCTTGGCTGCCCTCCATCTGG - Intronic
1049794753 8:144492044-144492066 CACATTGCCTGCCCTCCAGCTGG - Intronic
1049794770 8:144492091-144492113 CACACCACCTGCCCTCCGGCTGG - Intronic
1053613689 9:39742079-39742101 CAGATAACCTCCCCTCCAGCTGG - Intergenic
1053646623 9:40123727-40123749 TACCTTCCCTGCCCTCCAGTTGG - Intergenic
1053759095 9:41339840-41339862 TACCTTCCCTGCCCTCCAGTTGG + Intergenic
1053871729 9:42500035-42500057 CAGATAACCTCCCCTCCAGCTGG - Intergenic
1054239826 9:62600318-62600340 CAGATAACCTCCCCTCCAGCTGG + Intergenic
1054537948 9:66252246-66252268 TACCTTCCCTGCCCTCCAGTTGG + Intergenic
1054553958 9:66634845-66634867 CAGATAACCTCCCCTCCAGCTGG + Intergenic
1055604833 9:77957763-77957785 CACAGTTCCCTCCCTCCAGCAGG - Intronic
1057897357 9:98919908-98919930 CAAATGGCCTTCCCTCCTGCTGG - Intergenic
1059390511 9:113996850-113996872 CAGCTTGCCTGACATCCAGCAGG + Intronic
1059457276 9:114407451-114407473 CACAGTGCCTGCGCCACAGCAGG + Intronic
1059647309 9:116280175-116280197 CACAGTGCCTGGCATACAGCAGG - Intronic
1060218657 9:121753127-121753149 CACACTGCCTGCCTCCCACCAGG - Intronic
1060933249 9:127502124-127502146 CACCCTGCGTGCCCTCCGGCAGG + Intronic
1062440794 9:136568436-136568458 CAGATCACCTCCCCTCCAGCTGG - Intergenic
1202794413 9_KI270719v1_random:107161-107183 TACCTTCCCTGCCCTCCAGTTGG - Intergenic
1187401351 X:18963210-18963232 CACATATCCTTCCCTGCAGCTGG - Intronic
1188747803 X:33868595-33868617 CACAATGCCAACCCACCAGCAGG - Intergenic
1189154364 X:38741719-38741741 CACCGTGCCTGGCCTCCAGTAGG + Intergenic
1189196733 X:39159922-39159944 CACAGGGCCTGGCATCCAGCAGG - Intergenic
1189364811 X:40380312-40380334 CACCTTGCCTCCCCTCCAGCTGG - Intergenic
1190391167 X:49933180-49933202 CACAGTGCCTCACCTACAGCAGG + Intronic
1190417619 X:50196561-50196583 CACATTGCCCAGCATCCAGCAGG - Intronic
1190962406 X:55265605-55265627 CACATCTCCTGCCCTCAAGCTGG + Intronic
1196843015 X:119875914-119875936 CACTATGCCTGGCCTCCACCTGG - Intronic
1199715393 X:150504059-150504081 CAGACTGCCAGTCCTCCAGCAGG - Intronic
1199943043 X:152642702-152642724 CACTTTGCCTGCCTTCCTGAGGG + Intronic
1200101227 X:153689849-153689871 CACATCGCCATCCCACCAGCAGG + Intronic
1200238665 X:154482304-154482326 GGCATTGCCAGTCCTCCAGCCGG + Intergenic
1201148918 Y:11084264-11084286 TACCTTCCCTGCCCTCCAGTTGG + Intergenic