ID: 1049794763

View in Genome Browser
Species Human (GRCh38)
Location 8:144492080-144492102
Sequence GGCCCCCAGAACCAGCCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049794748_1049794763 22 Left 1049794748 8:144492035-144492057 CCCCCAGAGCCAGCTGGAGGGCA 0: 1
1: 0
2: 4
3: 45
4: 323
Right 1049794763 8:144492080-144492102 GGCCCCCAGAACCAGCCGGAGGG No data
1049794752_1049794763 19 Left 1049794752 8:144492038-144492060 CCAGAGCCAGCTGGAGGGCAGGC 0: 1
1: 0
2: 6
3: 41
4: 342
Right 1049794763 8:144492080-144492102 GGCCCCCAGAACCAGCCGGAGGG No data
1049794749_1049794763 21 Left 1049794749 8:144492036-144492058 CCCCAGAGCCAGCTGGAGGGCAG 0: 1
1: 0
2: 7
3: 76
4: 496
Right 1049794763 8:144492080-144492102 GGCCCCCAGAACCAGCCGGAGGG No data
1049794753_1049794763 13 Left 1049794753 8:144492044-144492066 CCAGCTGGAGGGCAGGCAATGTG 0: 1
1: 0
2: 6
3: 27
4: 304
Right 1049794763 8:144492080-144492102 GGCCCCCAGAACCAGCCGGAGGG No data
1049794750_1049794763 20 Left 1049794750 8:144492037-144492059 CCCAGAGCCAGCTGGAGGGCAGG 0: 1
1: 1
2: 1
3: 63
4: 450
Right 1049794763 8:144492080-144492102 GGCCCCCAGAACCAGCCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049794763 Original CRISPR GGCCCCCAGAACCAGCCGGA GGG Intronic
No off target data available for this crispr