ID: 1049796283

View in Genome Browser
Species Human (GRCh38)
Location 8:144498644-144498666
Sequence TCTGGTGTGCCTCCTGCCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 202}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049796278_1049796283 -10 Left 1049796278 8:144498631-144498653 CCCACCCCTGGGCTCTGGTGTGC 0: 1
1: 0
2: 2
3: 35
4: 452
Right 1049796283 8:144498644-144498666 TCTGGTGTGCCTCCTGCCATCGG 0: 1
1: 0
2: 2
3: 17
4: 202
1049796270_1049796283 22 Left 1049796270 8:144498599-144498621 CCTGGGCCAGACAGATGCCTGGT 0: 1
1: 0
2: 0
3: 19
4: 267
Right 1049796283 8:144498644-144498666 TCTGGTGTGCCTCCTGCCATCGG 0: 1
1: 0
2: 2
3: 17
4: 202
1049796277_1049796283 -9 Left 1049796277 8:144498630-144498652 CCCCACCCCTGGGCTCTGGTGTG 0: 1
1: 0
2: 0
3: 45
4: 412
Right 1049796283 8:144498644-144498666 TCTGGTGTGCCTCCTGCCATCGG 0: 1
1: 0
2: 2
3: 17
4: 202
1049796276_1049796283 -8 Left 1049796276 8:144498629-144498651 CCCCCACCCCTGGGCTCTGGTGT 0: 1
1: 0
2: 7
3: 89
4: 787
Right 1049796283 8:144498644-144498666 TCTGGTGTGCCTCCTGCCATCGG 0: 1
1: 0
2: 2
3: 17
4: 202
1049796268_1049796283 26 Left 1049796268 8:144498595-144498617 CCGGCCTGGGCCAGACAGATGCC 0: 1
1: 0
2: 4
3: 56
4: 548
Right 1049796283 8:144498644-144498666 TCTGGTGTGCCTCCTGCCATCGG 0: 1
1: 0
2: 2
3: 17
4: 202
1049796272_1049796283 5 Left 1049796272 8:144498616-144498638 CCTGGTGCTTCTGCCCCCACCCC 0: 1
1: 0
2: 10
3: 73
4: 706
Right 1049796283 8:144498644-144498666 TCTGGTGTGCCTCCTGCCATCGG 0: 1
1: 0
2: 2
3: 17
4: 202
1049796271_1049796283 16 Left 1049796271 8:144498605-144498627 CCAGACAGATGCCTGGTGCTTCT 0: 1
1: 0
2: 0
3: 13
4: 193
Right 1049796283 8:144498644-144498666 TCTGGTGTGCCTCCTGCCATCGG 0: 1
1: 0
2: 2
3: 17
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049796283 Original CRISPR TCTGGTGTGCCTCCTGCCAT CGG Intronic
900300678 1:1975463-1975485 TCTGATTTGCCTCCTGAGATCGG + Intronic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
900574348 1:3375631-3375653 TGTGCTGTGCCCCCTGCCACAGG - Intronic
900603113 1:3511614-3511636 ACTGGTGTGGCTGCAGCCATGGG + Exonic
900992289 1:6103602-6103624 TCTGCGGTGCCTCCTGGCAAAGG - Exonic
901784044 1:11612847-11612869 TCTGTTCTGCCTCATGCCAAAGG + Intergenic
905298397 1:36969191-36969213 TCTTGACTGGCTCCTGCCATTGG - Intronic
905878865 1:41450668-41450690 TCTTGTGTGGATCCTGCTATCGG - Intergenic
906178066 1:43792932-43792954 TCAGGTGGGCCTCATACCATGGG + Intronic
906225590 1:44118958-44118980 CCTGGTGCGCCGCCTGCCACCGG - Exonic
906823788 1:48956848-48956870 CATGGTGTGTGTCCTGCCATTGG - Intronic
909135613 1:71796222-71796244 TCTGTAGTGCCTCCTGAGATGGG - Intronic
909231679 1:73099780-73099802 TAGGGTGTGCCTCCTTCCACAGG + Intergenic
909350406 1:74646141-74646163 TCTGCTGTCCCTCCTACCGTAGG - Intronic
910208371 1:84770302-84770324 TCTGGGCTCCCTCCTGCCAGAGG + Intergenic
910979343 1:92943655-92943677 TCTGGGGTCCCTCGTGCCAGCGG - Intronic
912469353 1:109895922-109895944 CCTGGTGTTCCTCCTCCCCTCGG + Intergenic
916045910 1:160999809-160999831 TCTGCTTTTCATCCTGCCATTGG - Intronic
918144014 1:181740113-181740135 TCTGTTGTGCCTCCTGGAAGAGG - Intronic
1063474384 10:6315718-6315740 TCAGGTGATCCTCCTGCCTTGGG + Intergenic
1065949269 10:30637077-30637099 TCAGGTGAGCCTCCTGCCTCAGG + Intergenic
1067345437 10:45434843-45434865 TCTGGGGAGCCTCCTTTCATAGG - Intronic
1069007646 10:63336224-63336246 TCAGGTGATCCTCCTGCCTTCGG - Intronic
1069728041 10:70593836-70593858 GCTTCTGTGCTTCCTGCCATTGG + Intergenic
1070001294 10:72379784-72379806 TCTGGTGTCCTTCCTACCATAGG + Intronic
1070060943 10:72982006-72982028 TCTGGTGTGCTTCCTGCCCTGGG - Intergenic
1070920566 10:80183036-80183058 CCTGGTGCCCCTCCTGGCATGGG + Intronic
1074955310 10:118383150-118383172 ACTGGTCTGCCTCCTGCCCCAGG - Intergenic
1075263756 10:120983923-120983945 GCTGGTGTGCCTCATTCCAGTGG - Intergenic
1078582029 11:12546222-12546244 TCTCCTGTTCCTCCTGCCCTTGG + Intergenic
1080935519 11:36858690-36858712 CCTGGTGTTCCTCCAGTCATCGG + Intergenic
1083519587 11:63296010-63296032 TCTGGAGTGCATCCTGTCCTGGG - Intronic
1085512095 11:77093606-77093628 TCTGTCATGTCTCCTGCCATGGG + Intronic
1085610606 11:77945395-77945417 ACTAGTGTGCATCCTGCCCTGGG + Intronic
1088982924 11:114880151-114880173 TCTGGAATGCCTCCTCTCATGGG - Intergenic
1090071825 11:123550609-123550631 TCTTGAGTCCCTCCTGCCACTGG - Intronic
1092729314 12:11513446-11513468 TCTGGTGTTCCTCCTGCCCGTGG + Intergenic
1094476454 12:30844280-30844302 TCTGGTGTTCCTCCAGTCATCGG + Intergenic
1097645990 12:62235443-62235465 CCTGGTGCGCCGCCTGCCACTGG + Intronic
1100232545 12:92623012-92623034 TCTGTTTTCCCTTCTGCCATGGG + Intergenic
1103811490 12:123617812-123617834 TCTGGTGTTCCTCCTGCCCATGG + Exonic
1106734208 13:32572430-32572452 TCTGGGGTGACTCCAGCTATGGG + Intergenic
1108176988 13:47802163-47802185 TCTGGAGTGCCCCCTGTCATGGG - Intergenic
1108282375 13:48872650-48872672 TCTGGAGTCCCTGCTGGCATTGG - Intergenic
1111463658 13:88579165-88579187 TCTGGTTTTCCACCTGCCACCGG + Intergenic
1113129908 13:107024122-107024144 CCTGGTGTTCCTCCAGCCATCGG + Intergenic
1113176722 13:107573209-107573231 TTTGGTGTGCTTACTACCATTGG - Intronic
1113659576 13:112096433-112096455 TCCTCAGTGCCTCCTGCCATTGG + Intergenic
1117094638 14:52284570-52284592 TTTGGTATGGCTCCTTCCATTGG - Intergenic
1122308279 14:100779161-100779183 CTTGGTGTTCCCCCTGCCATGGG + Intergenic
1124023383 15:25943809-25943831 TCTGGTGTTCCTCCTTCCACTGG + Intergenic
1125087531 15:35747960-35747982 CCTGGTGTTCCTCCAGTCATCGG - Intergenic
1125887680 15:43240778-43240800 TCTGCCCTTCCTCCTGCCATGGG + Intronic
1128639303 15:69324314-69324336 TCTCCTGTGCCTTCTGCCCTTGG - Intronic
1128737043 15:70059189-70059211 CCTGGAGGGCCTCCTGCAATGGG - Intronic
1128795839 15:70465991-70466013 CCTGGTGTGCCTCAGGCCTTGGG - Intergenic
1131006903 15:88985862-88985884 GCTGGTGTTCCTCCAGTCATCGG - Intergenic
1132764158 16:1525984-1526006 CCTGGAGGGCCTCCTGCCACCGG + Exonic
1133406667 16:5529970-5529992 TGTTGTGTGCCTCTTGCCTTGGG - Intergenic
1136118014 16:28107948-28107970 TCTGTTTTGCCTCTGGCCATTGG + Intronic
1136238136 16:28927295-28927317 TCAAGTGATCCTCCTGCCATTGG - Intronic
1146507277 17:33416420-33416442 TCTTCTCTGCCTCCTCCCATGGG + Intronic
1146706176 17:35002243-35002265 CCTGGTGTGTGTCCAGCCATGGG + Intronic
1146833954 17:36094879-36094901 CCTGGGGTGCCTGCTGCCAAAGG - Intergenic
1147731607 17:42607262-42607284 TCTGGTGATCCTCCTGCCTTGGG - Intronic
1149281306 17:55108428-55108450 ACTGGTGTTCCAGCTGCCATTGG + Intronic
1149342794 17:55703773-55703795 TCTGTTGTGCTTCCTGACACTGG + Intergenic
1150538998 17:66076730-66076752 GCTGGTTGGCCTCCTGCCAGAGG - Intronic
1152585851 17:81189147-81189169 TCTGGAGTCTCTCCAGCCATAGG + Intergenic
1158308124 18:56128578-56128600 TCTAGTGTGGATCCTGCAATTGG + Intergenic
1160026188 18:75218605-75218627 GCAGGTGTGGCTCCTGCCCTTGG - Intronic
1161026790 19:2040631-2040653 TCGGGTGTTTCTCCTGCCAGAGG - Intronic
1161406605 19:4094645-4094667 TCTGTTCTGCCTCCTGGCAGAGG + Intronic
1162192590 19:8958863-8958885 TATGGTCTTCCTCCTGCCAGAGG + Exonic
1163102686 19:15107644-15107666 ACTGGGGTGCCTCCAGCCAGGGG + Intronic
1163613903 19:18315247-18315269 TCAGGTGATCCTCCTGCCTTAGG + Intronic
1164829754 19:31311415-31311437 TCTGGCCTGCCTCCTGTCACAGG + Intronic
1164936800 19:32221058-32221080 CCTGGCTTGCCTTCTGCCATGGG - Intergenic
1165658843 19:37557010-37557032 TATGGGCTGCCTGCTGCCATAGG - Intronic
1166627456 19:44371886-44371908 TCTGGTGTGACTCCTGACTCTGG - Intronic
1167468905 19:49664694-49664716 CCTGCTGTGCATCCTGCCGTAGG + Exonic
1167534618 19:50041783-50041805 TCTGGGCTTCCTCCTGCCAGAGG - Exonic
1168542400 19:57224027-57224049 TCAAGTGAGCCTCCTGCCTTGGG - Intergenic
925044718 2:764051-764073 TCTGGAGTCCCTCCTTCCCTGGG + Intergenic
926632199 2:15146858-15146880 GGTTGTGTGCCACCTGCCATGGG + Intergenic
927508034 2:23627144-23627166 TCCGCTGTGCCTCCTGCCGTGGG + Intronic
928309681 2:30199032-30199054 TATGGTGTGTCTCCTGCCTAAGG - Intergenic
928443193 2:31311027-31311049 GCTGGTTGGCCTCCTGCCAGGGG + Intergenic
932853214 2:75207720-75207742 TCTGGTGATCCGCCTGCCTTGGG + Intergenic
934028933 2:88024365-88024387 CCTGGTGTTCCTCCAGTCATCGG - Intergenic
934135804 2:88995353-88995375 CCTGGTGTTCCTCCAGTCATTGG + Intergenic
934220507 2:90077943-90077965 TCTGGTGTTCCTCCAGTCACTGG - Intergenic
934233140 2:90205171-90205193 CCTGGTGTTCCTCCAGTCATCGG - Intergenic
939112792 2:138028475-138028497 ACTGGTGTTCCTCCAGTCATCGG - Intergenic
941166397 2:162087608-162087630 GCTGGTGCGCCTACTGCCAATGG - Intergenic
941378039 2:164754937-164754959 TCAAGTGATCCTCCTGCCATGGG - Intronic
944684250 2:202104412-202104434 TGTGGTGTGCCTCCTCCTCTTGG - Intronic
945314309 2:208355028-208355050 TCTGTTGTGCCACATGCCATGGG - Intronic
1168892913 20:1306265-1306287 GCTGGTGTACCTCCTGCCTTGGG - Exonic
1170605711 20:17873897-17873919 GAGGGTGTCCCTCCTGCCATGGG - Intergenic
1171052274 20:21871057-21871079 TCAGGTGTGGCTCCTGACCTGGG + Intergenic
1171373829 20:24678422-24678444 TAAGGTCTGCCTCCTTCCATGGG + Intergenic
1171566309 20:26193423-26193445 TCAGGTGTTCTTCCTGCCAAGGG - Intergenic
1173009947 20:39172883-39172905 TCTGGTGATCCTCCTGCCTCAGG - Intergenic
1174483319 20:50845835-50845857 AGTGGTGTGGCTCCTCCCATGGG - Intronic
1175823684 20:61925096-61925118 TCTGCTGTGCCGCCTGCCCCGGG - Intronic
1175935407 20:62511658-62511680 TCTGGGGTGCCTTCTGCCCCAGG + Intergenic
1175991798 20:62793539-62793561 TCTGGAGCGCCTCCTCCCTTGGG - Intergenic
1176144989 20:63561582-63561604 TCAGGTGTGCCTGCTGTCTTTGG - Exonic
1176286824 21:5022898-5022920 ACGGCTGTGCGTCCTGCCATGGG - Intronic
1178025305 21:28459475-28459497 TCTCTTTTGCTTCCTGCCATGGG - Intergenic
1179157790 21:38864938-38864960 TCTCTTCTGCCTTCTGCCATGGG + Intergenic
1179650974 21:42808471-42808493 CCTGGTGTTCCTCCACCCATCGG + Intergenic
1179870357 21:44240577-44240599 ACGGCTGTGCGTCCTGCCATGGG + Intronic
1180840785 22:18957945-18957967 TCAGGTGGGGCTGCTGCCATAGG - Intergenic
1181060701 22:20280829-20280851 TCAGGTGGGGCTGCTGCCATAGG + Intronic
1181511572 22:23391570-23391592 TCTGGTGCTCCTCACGCCATTGG - Intergenic
1182670034 22:31988133-31988155 CCTGGTGTTCCTCCAGTCATCGG - Intergenic
1182712532 22:32331830-32331852 CCTGGGGTTCCTCCTGCCACGGG + Intergenic
1183656093 22:39185546-39185568 TCTGGGGACCCGCCTGCCATGGG + Intergenic
1184060350 22:42077692-42077714 TCTGGCGTGCGTCCTGCAACTGG - Exonic
1184817978 22:46886423-46886445 TCTGGGGCACCTCCTCCCATTGG + Intronic
949533099 3:4976981-4977003 TTTGGGCTCCCTCCTGCCATCGG + Intergenic
950427144 3:12930597-12930619 TCTGATGGCCCTCCTGCCCTGGG + Intronic
950505851 3:13394058-13394080 TCTGCAGTGCCCCCTGCCCTGGG - Intronic
952201418 3:31132248-31132270 TGTGGTGTCCCTCATGCCACTGG + Intergenic
952946238 3:38479403-38479425 TATGGGGTTACTCCTGCCATAGG + Intronic
954536133 3:51360751-51360773 ACTTATGTGGCTCCTGCCATAGG + Intronic
956707673 3:72013272-72013294 TCTGTGCTGCCTCCTCCCATGGG - Intergenic
958628601 3:96658175-96658197 TCTGGTGTTCCTCCACTCATCGG + Intergenic
965140623 3:164829330-164829352 CCTAGTGAGCCTCCTTCCATGGG + Intergenic
965819095 3:172666613-172666635 CCTGGTGTTCCTCCAGTCATCGG + Intronic
966456843 3:180127557-180127579 TCTGGTGTTCCTCCACTCATTGG - Intergenic
968600102 4:1504597-1504619 TCTGCTGTGACCCCTGCCCTTGG - Intergenic
971730898 4:30378527-30378549 TCTGGTGTGCCTCATTGCTTTGG - Intergenic
974913970 4:68156985-68157007 CCTGGTGTTCCTCCAGTCATTGG - Intergenic
975683767 4:76899847-76899869 TTTGGTGTTCCTCCTGCCTTAGG - Intergenic
976725937 4:88215724-88215746 TCTGCTGTGCCCCCTGGCAAGGG + Intronic
978348254 4:107794373-107794395 TCTGGTGTGATTACAGCCATGGG - Intergenic
980096913 4:128501150-128501172 TCTGGTGTGCACCCTGCTCTGGG + Intergenic
982801067 4:159708503-159708525 TCTGATGTGCCACCTGCCCTGGG + Intergenic
983043113 4:162954178-162954200 CCTGGTGTTCCTCCAGTCATTGG - Intergenic
984862214 4:184251509-184251531 CCTGGTGTTCCTCCAGTCATGGG - Intergenic
985060292 4:186071325-186071347 TCTGGTAGGGCTCCTGCTATAGG - Intronic
985576210 5:674611-674633 TCTGGTGGGTCACCAGCCATGGG - Intronic
986116204 5:4777616-4777638 TGTGGTTTGCCTCCTTCCATAGG + Intergenic
986782921 5:11083846-11083868 TCTGGGGTGCCTGCCCCCATGGG - Intronic
987175484 5:15303902-15303924 TCTGGTGTGGCTGCTGACAAAGG - Intergenic
987359047 5:17090164-17090186 TGTGGTGTGCCTCTTCCCAGCGG + Intronic
987372501 5:17206520-17206542 TCAGGTGATCCTCCTGCCTTGGG - Intronic
991575016 5:68093579-68093601 ACTGGTGTCCCCACTGCCATGGG - Intergenic
992223602 5:74597003-74597025 TCTGGCTAGTCTCCTGCCATGGG + Intergenic
992344820 5:75865970-75865992 CCTGTTGTAACTCCTGCCATTGG + Intergenic
993831173 5:92760065-92760087 TCTTGTGTGTTTCCTGACATTGG - Intergenic
997006965 5:129828713-129828735 TCTGCTCTACCTGCTGCCATTGG - Intergenic
997043279 5:130282376-130282398 GCTGGTTTGCCTTCTGCCAAAGG + Intergenic
997809930 5:136957180-136957202 TCTGGTTTTCCACCTGCCAGGGG - Intergenic
1000057082 5:157616658-157616680 CTTGGTGTCCCTCCTGCCAAGGG - Intergenic
1000416098 5:160985263-160985285 TCAGGTCTGTCTCCAGCCATGGG - Intergenic
1001298850 5:170518947-170518969 TCTGTAATCCCTCCTGCCATTGG - Intronic
1001879246 5:175228972-175228994 TCTCCTTTGCCTTCTGCCATGGG - Intergenic
1002868966 6:1148445-1148467 CCTGCTTTGCCTTCTGCCATGGG - Intergenic
1002958717 6:1893910-1893932 TCAGGAGCGCCTCCTGCCAGCGG - Intronic
1003015022 6:2461499-2461521 TCTGTGGTCCCTCCTGCAATGGG - Intergenic
1006434629 6:34019841-34019863 CCAGGCGTCCCTCCTGCCATGGG + Intronic
1008083771 6:47222082-47222104 CCTGGTGTTCCTCCACCCATTGG + Intergenic
1008845372 6:55957208-55957230 CCTGGTGTTCCTCCAGTCATCGG - Intergenic
1010398984 6:75426937-75426959 ACTGGTTTCCCTGCTGCCATCGG - Intronic
1011356654 6:86478584-86478606 TATGGGCTGCCTGCTGCCATAGG + Intergenic
1011927268 6:92661895-92661917 ACAGGTGTGCCTCCTCCCCTTGG - Intergenic
1013913725 6:115309993-115310015 TCTGGTTGGCCTCCTGCTAGGGG + Intergenic
1014199331 6:118590916-118590938 CCTGGTGTTCCTCCGGTCATCGG + Intronic
1015350555 6:132213033-132213055 TCTTGTTAGCCTCCTGCCAGGGG - Intergenic
1015984868 6:138874857-138874879 TCAAGTGTTCCTCCTGCCTTGGG - Intronic
1019348895 7:544025-544047 ACTGGTCTGCCTCCTGCCCCAGG + Intergenic
1019736128 7:2650626-2650648 TCGGGTCTGCCTCCTGCCTCGGG - Intronic
1020116588 7:5479730-5479752 TCTGGTGTGGGTCCCACCATCGG + Intronic
1020651570 7:10882636-10882658 CCTGGTGTTCCTCCAGTCATTGG + Intergenic
1022220825 7:28311902-28311924 GCTGGTGTGGCTCCTCCCATAGG + Intronic
1024428214 7:49254222-49254244 TCAGGTGTGATTCCTGCCTTTGG + Intergenic
1025842498 7:65163651-65163673 ACTAGTGTGCATCCTGCCCTGGG - Intergenic
1025880547 7:65532318-65532340 ACTAGTGTGCATCCTGCCCTGGG + Intergenic
1025892890 7:65670286-65670308 ACTAGTGTGCATCCTGCCCTGGG - Intergenic
1026874475 7:73871494-73871516 TCTGGGGTCCCTCCAGCCACAGG - Intergenic
1028297764 7:89156347-89156369 TCTGGTGATCCACCTGCCTTGGG + Intronic
1028590233 7:92485309-92485331 CCTGGTGTTCCTCCAGTCATTGG + Intergenic
1030407092 7:109128724-109128746 CCTGGTGTCCCTCCAGTCATCGG - Intergenic
1031035683 7:116785350-116785372 CCTGCTTTGCCTTCTGCCATGGG - Intronic
1031232804 7:119131352-119131374 TCTCTTCTGCCTTCTGCCATGGG - Intergenic
1032448172 7:132002776-132002798 TCCAGTGTGCCTCCTGCTGTGGG - Intergenic
1032762797 7:134960085-134960107 TTTGGTGTGCCTGCTGCAGTGGG - Exonic
1033582228 7:142748699-142748721 TCTCATGTGCATCCTGTCATAGG - Intergenic
1033585265 7:142770210-142770232 TCTCATGTGCATCCTGTCATAGG - Intergenic
1033763425 7:144461664-144461686 TCTGCCTTGCCTTCTGCCATGGG + Intronic
1034671289 7:152860417-152860439 TCTGCTGTGCCGCCAGCCAGAGG + Intergenic
1034684808 7:152960679-152960701 TCAAGTGATCCTCCTGCCATGGG - Intergenic
1038010835 8:23474770-23474792 TCAAGAGAGCCTCCTGCCATAGG + Intergenic
1038439057 8:27558956-27558978 TCAGGTCTGCCTCCCGCCCTGGG - Intergenic
1038489987 8:27963999-27964021 TCTGTTGGGTGTCCTGCCATGGG - Intronic
1038535794 8:28352050-28352072 TGTGGGATGCCTCCTGCCAGAGG - Intronic
1040603712 8:48909747-48909769 TCTGATTTCCTTCCTGCCATGGG + Intergenic
1042099644 8:65261127-65261149 TATGGTGGGCCACCTGCCAGAGG + Intergenic
1042867216 8:73366565-73366587 GCTGGTGCGCCTTCTGCCTTAGG + Intergenic
1048798422 8:138172901-138172923 ACTTGTGTGGCTTCTGCCATGGG - Intronic
1049796283 8:144498644-144498666 TCTGGTGTGCCTCCTGCCATCGG + Intronic
1050296906 9:4214543-4214565 TCTGTTGTTCCTCCTGGCGTGGG - Intronic
1052295774 9:26894876-26894898 TGTGGTGTTCCTCCAGTCATTGG + Intergenic
1052900963 9:33794781-33794803 TCTCATGTGCATCCTGTCATAGG - Intronic
1056461710 9:86815207-86815229 TTTGGTGTGCCGGCTGCCCTCGG - Intergenic
1057518029 9:95738065-95738087 TCTGCTCTGCCTCCTACCCTTGG - Intergenic
1057803786 9:98206488-98206510 TCAAGTGCCCCTCCTGCCATAGG + Intronic
1057895341 9:98904452-98904474 TCTGGTGTCCCTCCTGCCAAAGG - Intergenic
1060395385 9:123312913-123312935 TTTGGGGTGCCACCTGCCAGAGG + Intergenic
1061543540 9:131290789-131290811 TCTGGTGGGCATCCTGGAATGGG + Intronic
1062572473 9:137191952-137191974 GCTAGGGTGCCTCCTGCCATCGG - Exonic
1203450567 Un_GL000219v1:110780-110802 TCTGGTGATTCTCCTGCCTTGGG + Intergenic
1189387301 X:40547877-40547899 GCTGTTGGGCCTCCTGCAATGGG + Intergenic
1192765203 X:74132840-74132862 GCTGGTGTTCCTCCAGTCATCGG + Intergenic
1194521412 X:94922738-94922760 TCTTGTGTTACTCCTGCCCTTGG + Intergenic
1198239810 X:134773296-134773318 TCTAGTGTGCTTCCTGCACTTGG - Intronic
1199798983 X:151230829-151230851 TGTGGTGTGCCTCCTGCCTCTGG - Intergenic
1200846700 Y:7837881-7837903 TATGGGCTGCCTGCTGCCATAGG + Intergenic