ID: 1049797522

View in Genome Browser
Species Human (GRCh38)
Location 8:144503487-144503509
Sequence GCCACGGTGTGAGCTGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049797520_1049797522 0 Left 1049797520 8:144503464-144503486 CCTGGTGAAAGGGCATGACAGCA 0: 1
1: 0
2: 3
3: 19
4: 253
Right 1049797522 8:144503487-144503509 GCCACGGTGTGAGCTGTCCCAGG No data
1049797516_1049797522 11 Left 1049797516 8:144503453-144503475 CCCAGCTGGTGCCTGGTGAAAGG 0: 1
1: 0
2: 0
3: 14
4: 206
Right 1049797522 8:144503487-144503509 GCCACGGTGTGAGCTGTCCCAGG No data
1049797512_1049797522 23 Left 1049797512 8:144503441-144503463 CCAAGGGCAACCCCCAGCTGGTG 0: 1
1: 0
2: 2
3: 23
4: 258
Right 1049797522 8:144503487-144503509 GCCACGGTGTGAGCTGTCCCAGG No data
1049797515_1049797522 12 Left 1049797515 8:144503452-144503474 CCCCAGCTGGTGCCTGGTGAAAG 0: 1
1: 0
2: 3
3: 13
4: 214
Right 1049797522 8:144503487-144503509 GCCACGGTGTGAGCTGTCCCAGG No data
1049797518_1049797522 10 Left 1049797518 8:144503454-144503476 CCAGCTGGTGCCTGGTGAAAGGG 0: 1
1: 1
2: 1
3: 25
4: 197
Right 1049797522 8:144503487-144503509 GCCACGGTGTGAGCTGTCCCAGG No data
1049797511_1049797522 24 Left 1049797511 8:144503440-144503462 CCCAAGGGCAACCCCCAGCTGGT 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1049797522 8:144503487-144503509 GCCACGGTGTGAGCTGTCCCAGG No data
1049797514_1049797522 13 Left 1049797514 8:144503451-144503473 CCCCCAGCTGGTGCCTGGTGAAA 0: 1
1: 0
2: 0
3: 19
4: 197
Right 1049797522 8:144503487-144503509 GCCACGGTGTGAGCTGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049797522 Original CRISPR GCCACGGTGTGAGCTGTCCC AGG Intronic
No off target data available for this crispr