ID: 1049800250

View in Genome Browser
Species Human (GRCh38)
Location 8:144514330-144514352
Sequence CAGCATCAGCACGTGTACCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 121}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049800247_1049800250 -7 Left 1049800247 8:144514314-144514336 CCAGTGCCTCAGGTGTCAGCATC 0: 1
1: 0
2: 0
3: 18
4: 186
Right 1049800250 8:144514330-144514352 CAGCATCAGCACGTGTACCTGGG 0: 1
1: 0
2: 2
3: 6
4: 121
1049800240_1049800250 3 Left 1049800240 8:144514304-144514326 CCCGCCCCCACCAGTGCCTCAGG 0: 1
1: 0
2: 2
3: 49
4: 558
Right 1049800250 8:144514330-144514352 CAGCATCAGCACGTGTACCTGGG 0: 1
1: 0
2: 2
3: 6
4: 121
1049800243_1049800250 -1 Left 1049800243 8:144514308-144514330 CCCCCACCAGTGCCTCAGGTGTC 0: 1
1: 0
2: 1
3: 18
4: 209
Right 1049800250 8:144514330-144514352 CAGCATCAGCACGTGTACCTGGG 0: 1
1: 0
2: 2
3: 6
4: 121
1049800244_1049800250 -2 Left 1049800244 8:144514309-144514331 CCCCACCAGTGCCTCAGGTGTCA 0: 1
1: 0
2: 0
3: 13
4: 179
Right 1049800250 8:144514330-144514352 CAGCATCAGCACGTGTACCTGGG 0: 1
1: 0
2: 2
3: 6
4: 121
1049800246_1049800250 -4 Left 1049800246 8:144514311-144514333 CCACCAGTGCCTCAGGTGTCAGC 0: 1
1: 0
2: 2
3: 20
4: 244
Right 1049800250 8:144514330-144514352 CAGCATCAGCACGTGTACCTGGG 0: 1
1: 0
2: 2
3: 6
4: 121
1049800242_1049800250 2 Left 1049800242 8:144514305-144514327 CCGCCCCCACCAGTGCCTCAGGT 0: 1
1: 0
2: 0
3: 35
4: 404
Right 1049800250 8:144514330-144514352 CAGCATCAGCACGTGTACCTGGG 0: 1
1: 0
2: 2
3: 6
4: 121
1049800239_1049800250 6 Left 1049800239 8:144514301-144514323 CCTCCCGCCCCCACCAGTGCCTC 0: 1
1: 0
2: 7
3: 84
4: 801
Right 1049800250 8:144514330-144514352 CAGCATCAGCACGTGTACCTGGG 0: 1
1: 0
2: 2
3: 6
4: 121
1049800245_1049800250 -3 Left 1049800245 8:144514310-144514332 CCCACCAGTGCCTCAGGTGTCAG 0: 1
1: 0
2: 1
3: 18
4: 186
Right 1049800250 8:144514330-144514352 CAGCATCAGCACGTGTACCTGGG 0: 1
1: 0
2: 2
3: 6
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049800250 Original CRISPR CAGCATCAGCACGTGTACCT GGG Exonic
900412380 1:2518607-2518629 CAACAGCAGCACGTGTGCTTTGG - Intronic
901462850 1:9401892-9401914 CAGCACCAGGACGGGAACCTCGG - Intergenic
902715738 1:18271578-18271600 CAGCAACCGCACTTGTACCTTGG - Intronic
903130575 1:21277058-21277080 CAGCACCAGCACCTGCTCCTGGG + Intronic
907396213 1:54191802-54191824 CATCATCAGCCAGAGTACCTGGG + Intronic
912922457 1:113882550-113882572 CAGCAGCATCACTTGAACCTGGG + Intronic
913441319 1:118900950-118900972 CATCATCAGTACATGTTCCTGGG - Intronic
916167670 1:161978202-161978224 CGGCCTCTGCACGTGTCCCTAGG - Intergenic
917043460 1:170831573-170831595 CAGGAGCATCACGTGTACCTGGG + Intergenic
917302792 1:173594990-173595012 CAGCAGCATCACTTGAACCTGGG - Intronic
920545522 1:206813429-206813451 CAGCTTCAGCATGTGTCCCTTGG + Intronic
921636317 1:217498864-217498886 CAGCATCAGCTGAGGTACCTTGG + Intronic
1066466721 10:35657921-35657943 CAGCATCAGCACCTGTATAACGG - Intergenic
1066621875 10:37363830-37363852 CAGCCTCAGCTCCTGTAGCTGGG - Intronic
1069042813 10:63712458-63712480 CAGCAGCTGCACATGTTCCTGGG + Intergenic
1069807260 10:71133817-71133839 CAGAGTCTGCACGTGTACCCTGG + Intergenic
1071184142 10:83021059-83021081 CAGGATAATCACTTGTACCTGGG + Intergenic
1072495920 10:95959280-95959302 CAGCATCATCACCTTCACCTGGG + Intronic
1073836499 10:107450313-107450335 AAGCATAAGAACCTGTACCTTGG + Intergenic
1076309305 10:129492673-129492695 CAGGATCAGCAAGTGTTTCTGGG + Intronic
1087159078 11:94931589-94931611 CAGCAGCAGCACCATTACCTGGG + Intergenic
1089610369 11:119665325-119665347 CAGCATCAGCGTGTGCTCCTGGG + Intronic
1090279634 11:125444879-125444901 CAGCATCACCACGTGTAAACAGG - Intergenic
1093997252 12:25655544-25655566 CAGCCTCAGCAGGTGAAGCTCGG - Intergenic
1096959891 12:55567692-55567714 AAGCAACAGCCCGAGTACCTGGG - Intergenic
1100980560 12:100159145-100159167 CAGCAGCAGGACCAGTACCTGGG - Intergenic
1102192249 12:110997475-110997497 CAGCATCAACACGAGGGCCTGGG - Intergenic
1103725966 12:122997516-122997538 CAGTAGCAGCACGTGGATCTTGG + Exonic
1103911381 12:124354429-124354451 CAGCATCTGCCCCTGTTCCTCGG - Intronic
1104907449 12:132221258-132221280 CAGCAGCATCACTTGAACCTGGG + Intronic
1106564327 13:30871678-30871700 CTGCAGCAGCACCTGTTCCTTGG - Intergenic
1107455947 13:40554642-40554664 TAGAATCAGGATGTGTACCTAGG - Intergenic
1110423528 13:75339666-75339688 CAGGAGAAGCACGTGAACCTGGG - Intronic
1111003810 13:82222136-82222158 CAGCATGAGCATGTGTGCCAAGG + Intergenic
1113529884 13:111015326-111015348 CAGGAGAAGCACTTGTACCTAGG + Intergenic
1113533755 13:111048224-111048246 CAGCATCAGCATGTTTACCTGGG - Intergenic
1121123235 14:91389502-91389524 CATCATCAACAGGAGTACCTTGG + Intronic
1122423231 14:101590391-101590413 CAGCCCCAGCACGTATCCCTGGG + Intergenic
1122522507 14:102354974-102354996 CAGCAGAATCACTTGTACCTGGG + Intronic
1122884159 14:104703177-104703199 CAGGGTCAGCACGTGGCCCTCGG - Exonic
1127854041 15:62940367-62940389 CAGGGTCTGAACGTGTACCTAGG - Intergenic
1135494204 16:22937414-22937436 CAGGATAATCACTTGTACCTGGG - Intergenic
1136604154 16:31321347-31321369 GAGCAGCAGCACGTGCCCCTGGG - Exonic
1140266431 16:73425266-73425288 CAGCATCAGCACGCATCCCAAGG - Intergenic
1143717549 17:8785833-8785855 CAGCAGCAGCACCTGATCCTCGG + Intergenic
1146617350 17:34367555-34367577 CAGCATCAGCACATGAACCCAGG + Intergenic
1151461770 17:74258591-74258613 CAGCAGCAGCAGCTTTACCTAGG - Intronic
1151927840 17:77211844-77211866 CAGCTTCAGCACCTGCACCCTGG + Intronic
1152147093 17:78574896-78574918 CAGCACCAGCACCTGGACGTCGG + Exonic
1156507242 18:37605647-37605669 CTGCCTCAGCACCTGTAGCTGGG + Intergenic
1159822847 18:73167664-73167686 CAGCATGAGCATGTTTTCCTTGG - Intronic
1160959513 19:1713136-1713158 GAGCATCAGCATGTGCACATGGG + Intergenic
1161645803 19:5452671-5452693 CAGCATCAGCACCTGCACTGCGG - Intergenic
1162900636 19:13793661-13793683 CAGAATAATCACGTGAACCTGGG + Intergenic
1163397856 19:17074670-17074692 CAGCTACTGCACCTGTACCTGGG + Intronic
1167610688 19:50506527-50506549 CAGGATCAGCCCCAGTACCTGGG + Exonic
926223648 2:10952414-10952436 GAGCTTCAGCACAGGTACCTGGG - Intergenic
928687877 2:33768076-33768098 CAGCATCAGCAACAGTTCCTTGG - Intergenic
932596246 2:73095448-73095470 CAGCAGCAGCATGGGTAGCTGGG - Intronic
938118743 2:128619574-128619596 CAGCACCAGCCCATGTTCCTAGG - Intergenic
940735327 2:157444743-157444765 CAGCATCAGCAAGTGGTCCCAGG + Intronic
947161535 2:227220273-227220295 CAGGATAATCACGTGAACCTGGG - Intronic
948137784 2:235649695-235649717 CAGCATCAGCACAGCCACCTGGG - Intronic
948608514 2:239151875-239151897 CAGCATCCTCATGTGTCCCTGGG - Intronic
1173308578 20:41875247-41875269 CAGCATTAACACCTGTACCATGG - Intergenic
1175763561 20:61577782-61577804 GAGCATCAGCATGTTTTCCTGGG - Intronic
1175874595 20:62223398-62223420 CAGCAGCAGCAGGTGGGCCTTGG - Intergenic
1176979082 21:15358616-15358638 CAGCATCATCAGGATTACCTGGG - Intergenic
1178890136 21:36514169-36514191 CAGAATCAGAAGGTGTAGCTGGG + Intronic
1179329173 21:40382126-40382148 TAGCATCAGCTGGTATACCTTGG + Intronic
1180705208 22:17805291-17805313 CAGCAGCAGCACGCACACCTGGG + Intronic
1182337076 22:29591103-29591125 CAGAAGCAGCACTTGAACCTGGG + Intergenic
1182713007 22:32334346-32334368 CAGCAACACCACGTGTCTCTTGG + Intergenic
1182866308 22:33607366-33607388 CAGGAGCAGCACTTGAACCTGGG + Intronic
1183287954 22:36979625-36979647 CAGCATCAGGACGTGTCCCTTGG + Intergenic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1184400271 22:44269911-44269933 CAGCAACACCACGTGTCTCTTGG + Intronic
1184481765 22:44752456-44752478 CAGGGTCAGCTCGTGCACCTGGG + Intronic
949268567 3:2188283-2188305 CTGCATCAGCAAGAGTCCCTAGG + Intronic
955376299 3:58400079-58400101 CAGCTTCACCACTTCTACCTGGG + Intronic
957997233 3:87705957-87705979 CAGCATCAGCATCTGCTCCTGGG - Intergenic
967219856 3:187239468-187239490 CAGCATCAGTATTAGTACCTAGG + Intronic
985864102 5:2498657-2498679 CAGGGTCAGCACTTGTATCTGGG - Intergenic
987088193 5:14488200-14488222 CCGCATGAGCACGTGCTCCTCGG + Exonic
988157927 5:27478509-27478531 AAGAATCAGCACATGTAGCTTGG + Intergenic
990447066 5:55903284-55903306 CAGCACCAGCACGTGAGCCCCGG + Intronic
995772004 5:115680867-115680889 AAGCATCAGCACATTTACTTTGG + Intergenic
997664258 5:135615953-135615975 AAGCAGCAGCCCATGTACCTGGG - Intergenic
998001442 5:138629136-138629158 CAGCTTCAGCACCTGCCCCTGGG + Intronic
998866148 5:146504951-146504973 CAGGAGCATCACTTGTACCTGGG + Intronic
998914649 5:147000788-147000810 CACCATCAGCAAATGTCCCTTGG + Intronic
1000011605 5:157238677-157238699 CACCATCAGCTCCTGAACCTCGG - Intronic
1000586244 5:163102339-163102361 CAGCACCTCCACGTGTTCCTTGG + Intergenic
1001772102 5:174304366-174304388 CAGCATAATCACTTGAACCTGGG - Intergenic
1003293546 6:4803675-4803697 CAGCATCAGCACGTGGCCTCGGG + Intronic
1006423983 6:33952307-33952329 GAGCCTCAGCACCTGGACCTGGG + Intergenic
1009833634 6:68970395-68970417 CTGCTTCAGCACCTGTAGCTGGG + Intronic
1011495524 6:87933571-87933593 CAGCTTCAGCACCAGTGCCTGGG + Intergenic
1011530228 6:88312892-88312914 CAGCAGCAGCAGCTGCACCTGGG + Intergenic
1017655324 6:156622201-156622223 CAGCATAAGCCCAGGTACCTGGG + Intergenic
1021141643 7:17033352-17033374 CAGCTCCAGCACTGGTACCTAGG + Intergenic
1023358984 7:39396723-39396745 AAGCAGCAGCACTTGTGCCTAGG + Intronic
1023841531 7:44101158-44101180 CAGCACCAGCATGTGTATCTGGG - Intergenic
1026477248 7:70747549-70747571 CAGCAAAATCACTTGTACCTGGG - Intronic
1027400733 7:77803465-77803487 CAGTATCAGGACTTGAACCTAGG - Intronic
1030006299 7:105124003-105124025 CATCATCACCACGTATACTTAGG - Intronic
1031979364 7:128114800-128114822 CAGCACCAGGACTTGAACCTGGG - Intergenic
1033445576 7:141418998-141419020 CAGGATAATCACTTGTACCTGGG - Intronic
1034679727 7:152919472-152919494 CAGGATCCGCACTTGAACCTTGG + Intergenic
1035438953 7:158879985-158880007 AAGCATCAGAAGGGGTACCTGGG - Exonic
1040387431 8:46922947-46922969 CAGCCCCAGCACCTGCACCTAGG + Intergenic
1040986778 8:53303830-53303852 TAGTATCAGCATGTCTACCTTGG - Intergenic
1042271538 8:66961487-66961509 CAGCAGCAGCACGTCCAGCTTGG + Exonic
1047523036 8:125610068-125610090 CAGCACCACCACCTCTACCTGGG - Intergenic
1049800250 8:144514330-144514352 CAGCATCAGCACGTGTACCTGGG + Exonic
1050541926 9:6677961-6677983 CAGCATAATCACTTGAACCTGGG + Intergenic
1052514328 9:29460776-29460798 CAGGATAATCACTTGTACCTGGG - Intergenic
1053129990 9:35609343-35609365 CTTCATCAGCACCTGTTCCTCGG + Exonic
1053149782 9:35736111-35736133 CAGCAGCAGCACCTGCATCTTGG + Exonic
1058224703 9:102345865-102345887 AAGCCTCAGCATGTTTACCTGGG - Intergenic
1060889496 9:127179096-127179118 CAGCATCAGCACTTCTCCCAAGG - Intronic
1062726437 9:138076592-138076614 CAGCATCAGCTGCTGTTCCTGGG + Intronic
1185465596 X:352644-352666 CAGCACCATCACGTGGGCCTTGG - Intronic
1187179337 X:16929008-16929030 CAGCCTCAGCCCATGTAGCTGGG - Intergenic
1189471003 X:41314130-41314152 CAGCATAATCACTTGAACCTGGG + Intergenic
1189956223 X:46277437-46277459 CTGCTTCAGCACGTGTCCCTCGG + Intergenic
1192491396 X:71579467-71579489 CAGCACCACCACGTGCTCCTAGG - Intronic
1202280074 Y:23174739-23174761 CAGCAGCATCACGTGATCCTGGG - Intronic
1202280803 Y:23185584-23185606 CAGCAGCATCACGTGATCCTGGG - Intronic
1202436761 Y:24847323-24847345 CAGCAGCATCACGTGATCCTGGG + Intronic