ID: 1049801085

View in Genome Browser
Species Human (GRCh38)
Location 8:144517832-144517854
Sequence CTCCCGCGCAGCCGTCGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 65}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049801077_1049801085 10 Left 1049801077 8:144517799-144517821 CCCGGCCTCCGCGCTTGCGATCG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1049801085 8:144517832-144517854 CTCCCGCGCAGCCGTCGCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 65
1049801079_1049801085 5 Left 1049801079 8:144517804-144517826 CCTCCGCGCTTGCGATCGTCCAG 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1049801085 8:144517832-144517854 CTCCCGCGCAGCCGTCGCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 65
1049801076_1049801085 13 Left 1049801076 8:144517796-144517818 CCGCCCGGCCTCCGCGCTTGCGA 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1049801085 8:144517832-144517854 CTCCCGCGCAGCCGTCGCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 65
1049801078_1049801085 9 Left 1049801078 8:144517800-144517822 CCGGCCTCCGCGCTTGCGATCGT 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1049801085 8:144517832-144517854 CTCCCGCGCAGCCGTCGCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 65
1049801073_1049801085 28 Left 1049801073 8:144517781-144517803 CCATGGCGCGCGCGCCCGCCCGG 0: 1
1: 0
2: 3
3: 35
4: 258
Right 1049801085 8:144517832-144517854 CTCCCGCGCAGCCGTCGCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 65
1049801075_1049801085 14 Left 1049801075 8:144517795-144517817 CCCGCCCGGCCTCCGCGCTTGCG 0: 1
1: 0
2: 1
3: 17
4: 177
Right 1049801085 8:144517832-144517854 CTCCCGCGCAGCCGTCGCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 65
1049801080_1049801085 2 Left 1049801080 8:144517807-144517829 CCGCGCTTGCGATCGTCCAGCGA 0: 1
1: 0
2: 0
3: 1
4: 6
Right 1049801085 8:144517832-144517854 CTCCCGCGCAGCCGTCGCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049801085 Original CRISPR CTCCCGCGCAGCCGTCGCGG GGG Intronic