ID: 1049801368

View in Genome Browser
Species Human (GRCh38)
Location 8:144518950-144518972
Sequence CAGTGGCTCTCCAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049801362_1049801368 4 Left 1049801362 8:144518923-144518945 CCACATACTTAAGACTTGGTCTT 0: 1
1: 0
2: 9
3: 10
4: 126
Right 1049801368 8:144518950-144518972 CAGTGGCTCTCCAGGGAAGAGGG No data
1049801361_1049801368 5 Left 1049801361 8:144518922-144518944 CCCACATACTTAAGACTTGGTCT 0: 1
1: 0
2: 0
3: 4
4: 115
Right 1049801368 8:144518950-144518972 CAGTGGCTCTCCAGGGAAGAGGG No data
1049801359_1049801368 15 Left 1049801359 8:144518912-144518934 CCTTCTGAATCCCACATACTTAA 0: 1
1: 0
2: 1
3: 14
4: 182
Right 1049801368 8:144518950-144518972 CAGTGGCTCTCCAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049801368 Original CRISPR CAGTGGCTCTCCAGGGAAGA GGG Intronic
No off target data available for this crispr