ID: 1049801756

View in Genome Browser
Species Human (GRCh38)
Location 8:144521003-144521025
Sequence CAGGTCCAACTTCTTGAGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049801756_1049801761 -3 Left 1049801756 8:144521003-144521025 CCCACCTCAAGAAGTTGGACCTG 0: 1
1: 0
2: 1
3: 7
4: 155
Right 1049801761 8:144521023-144521045 CTGAGTGGTAACGACCTGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 50
1049801756_1049801762 8 Left 1049801756 8:144521003-144521025 CCCACCTCAAGAAGTTGGACCTG 0: 1
1: 0
2: 1
3: 7
4: 155
Right 1049801762 8:144521034-144521056 CGACCTGTCTGGCAGCCAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 152
1049801756_1049801764 20 Left 1049801756 8:144521003-144521025 CCCACCTCAAGAAGTTGGACCTG 0: 1
1: 0
2: 1
3: 7
4: 155
Right 1049801764 8:144521046-144521068 CAGCCAGCTGGCACCCTTCCAGG 0: 1
1: 0
2: 2
3: 25
4: 402
1049801756_1049801765 21 Left 1049801756 8:144521003-144521025 CCCACCTCAAGAAGTTGGACCTG 0: 1
1: 0
2: 1
3: 7
4: 155
Right 1049801765 8:144521047-144521069 AGCCAGCTGGCACCCTTCCAGGG 0: 1
1: 0
2: 0
3: 21
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049801756 Original CRISPR CAGGTCCAACTTCTTGAGGT GGG (reversed) Exonic
901568667 1:10141247-10141269 CAGGTTCATGATCTTGAGGTGGG + Intronic
902459948 1:16566925-16566947 CAGATCCAACATCTTGAGAGTGG + Intronic
904364824 1:30003574-30003596 CAGGCCCAACTCCTTGTGCTCGG - Intergenic
906807149 1:48790111-48790133 CAGGTCCAAATTGTTTAGCTTGG - Intronic
908031096 1:60000806-60000828 CAAGTCCAATTTCTTGGGGCAGG + Intronic
909466536 1:75979811-75979833 CAGGTATACCTTCTTGAGATGGG + Intergenic
909496981 1:76289646-76289668 CAGGTCCAACTTAATGGGGTTGG - Intronic
911111283 1:94189303-94189325 CAGGTCCAAATCCTGAAGGTTGG + Exonic
911822339 1:102437675-102437697 GTGGTCCTACTTCTTGGGGTTGG - Intergenic
913111713 1:115663204-115663226 GAAGTCCAACTTTTGGAGGTGGG - Intronic
916424678 1:164669337-164669359 CTCGTCCACTTTCTTGAGGTTGG + Intronic
917698481 1:177555349-177555371 CTGTGCCACCTTCTTGAGGTGGG + Intergenic
918265282 1:182836748-182836770 CAGTTCCAAATTCTTAAGATAGG + Intergenic
920601457 1:207329080-207329102 CTGGTCCATGTTCTTGAGGGTGG - Intronic
923691076 1:236193215-236193237 CATTTCAAACTTCTTGATGTGGG - Intronic
923839119 1:237648551-237648573 CTCCTCCATCTTCTTGAGGTTGG + Exonic
924445778 1:244128884-244128906 CAGATCCAGCTTCTTGAGACTGG + Intergenic
1063142507 10:3267986-3268008 CCGGTCCAAATTCCTGAGCTGGG + Intergenic
1065185043 10:23163376-23163398 TTGGTCCAAATTCTTGAGATGGG - Intergenic
1066715098 10:38277985-38278007 CAGGTCCCACTCCCAGAGGTTGG - Intergenic
1066782988 10:38972726-38972748 CAGGTCCCACTCCCAGAGGTTGG + Intergenic
1068153052 10:53158797-53158819 GAGGTACAACTTCTTTTGGTGGG + Intergenic
1069849106 10:71393603-71393625 CAGGTCCACTGTCTTCAGGTGGG + Intergenic
1070787393 10:79169890-79169912 CAGGAGCATCTGCTTGAGGTGGG + Intronic
1074061243 10:109967865-109967887 CTGATCCAAGTTCTTGAGTTTGG - Intergenic
1074361919 10:112830496-112830518 CAGGTGGACCTTCTTGAGATTGG - Intergenic
1074654803 10:115572876-115572898 CAGCTCAAACTGCTTGAGGGAGG + Intronic
1077104347 11:835567-835589 CAGGTGCAATCACTTGAGGTCGG - Intronic
1079121816 11:17691014-17691036 TATGTCCAACTTTTTGAGGAAGG - Intergenic
1079279783 11:19076812-19076834 CAGTGCCAACGCCTTGAGGTAGG - Intergenic
1080020383 11:27553819-27553841 CAGGTCAAATTTATTGATGTGGG - Intergenic
1081485510 11:43524868-43524890 CAGGACCATCTTCATCAGGTAGG - Intergenic
1083579859 11:63818125-63818147 CAGGACCAACTACCTGAGTTGGG - Exonic
1083817835 11:65147030-65147052 CAGGTCTCAATTCTGGAGGTGGG - Intergenic
1084680905 11:70665847-70665869 CCCGTCCACCTTCTTGAGCTGGG + Intronic
1085066407 11:73499258-73499280 CAGGTCCCTCTTCTGTAGGTAGG - Intronic
1085114557 11:73919206-73919228 CAGTTCAAACTCCTTGAGGGTGG + Intronic
1085135993 11:74088880-74088902 AAGGTCCAACTTCCTTAGCTTGG - Intronic
1085151516 11:74256125-74256147 CAGGTCCAAATTCTACAGCTTGG + Intronic
1085219082 11:74858223-74858245 CAGGTCCCTCTTCTTGAAATTGG - Intronic
1086327847 11:85722639-85722661 CATGTTAAACTTGTTGAGGTAGG - Intronic
1087922419 11:103881742-103881764 CATGTCAAACTTGTTGAGGGAGG - Intergenic
1088692779 11:112342057-112342079 CAGGTCCATCCTCTGGAGGATGG + Intergenic
1089612150 11:119675350-119675372 CAGGAACAGCTTCTTGAGGCTGG - Intronic
1091270003 11:134301669-134301691 CTGTTCTAATTTCTTGAGGTGGG + Intronic
1093471363 12:19505567-19505589 GAGGTGTAACATCTTGAGGTGGG + Intronic
1096190279 12:49613223-49613245 GAGATCTAACTTTTTGAGGTAGG - Intronic
1103483061 12:121263830-121263852 GTGGTCCAGCTTCTTGAGGATGG + Exonic
1108444737 13:50496708-50496730 CAGGTGCAACTTGTTGAGTGTGG + Intronic
1109119731 13:58439483-58439505 CAGCTCCATCTTCTTCAGTTGGG + Intergenic
1110134897 13:72054579-72054601 CAGGTCACAGTTCTTGAGGCTGG + Intergenic
1112656909 13:101461367-101461389 CATGTTCATGTTCTTGAGGTAGG + Intronic
1113504450 13:110805428-110805450 CAGGTCCAACTTCTATCTGTTGG - Intergenic
1115010006 14:28534700-28534722 GAGATCTAACTTCTTGATGTAGG + Intergenic
1115336147 14:32245850-32245872 CAGGACCTAATTCTTGAGGTGGG - Intergenic
1116746065 14:48820867-48820889 TCTTTCCAACTTCTTGAGGTAGG - Intergenic
1117740956 14:58818823-58818845 CTGCTTTAACTTCTTGAGGTTGG + Intergenic
1121719145 14:96097190-96097212 CATGTCTGACTTCTTGAGATAGG - Intergenic
1123711456 15:22990745-22990767 CAGATCTAAGTTCTTGAGATGGG + Intronic
1127369577 15:58325864-58325886 GAGATCTAACTTTTTGAGGTAGG + Intronic
1128913250 15:71536006-71536028 CAGGAGCAACTTCATGAGCTTGG - Intronic
1131271221 15:90948730-90948752 CAGCTCCACCATCTTGGGGTCGG - Exonic
1131653757 15:94431597-94431619 CAGTTACAACTTCTTGAGAAGGG + Intronic
1133234402 16:4381176-4381198 CAGGTCCAGGTTGCTGAGGTTGG - Exonic
1135187940 16:20331063-20331085 CAGGTGCAAAGTCCTGAGGTAGG - Intergenic
1137952505 16:52797130-52797152 CAGGTCCAACTTTTTGGGAAAGG - Intergenic
1140951405 16:79821901-79821923 TAGCTCCATCTTTTTGAGGTAGG - Intergenic
1141939652 16:87266425-87266447 TAGTACCCACTTCTTGAGGTAGG + Intronic
1142761266 17:2043070-2043092 CTGGTCCAAGAACTTGAGGTAGG - Exonic
1144487391 17:15678409-15678431 CAGGTCTAACTACAGGAGGTTGG - Intronic
1145868679 17:28256578-28256600 CAGGTCACACTGCTTCAGGTTGG + Intergenic
1147923422 17:43932544-43932566 CAGGTCACACTGCTTCAGGTGGG - Intergenic
1148340841 17:46872588-46872610 CAGGTCACACTGCTTCAGGTGGG - Exonic
1148699434 17:49578861-49578883 CAGGGCCACCGTCTTGATGTTGG - Exonic
1148737161 17:49871308-49871330 CGGGCCAAAGTTCTTGAGGTAGG - Intergenic
1150131282 17:62670620-62670642 CAGGTTCACCTTCTAGGGGTTGG - Intronic
1152303846 17:79510109-79510131 CAGGGCCAACTTCTGGTGGGTGG - Intronic
1156217843 18:35018926-35018948 AAGGTCCTTCTTTTTGAGGTAGG + Intronic
1157617673 18:48996870-48996892 CAGGTCTCACTTCTGGAGGACGG + Intergenic
1161498338 19:4599131-4599153 CAGCTCCAACTGCTCCAGGTGGG + Intergenic
1161762682 19:6185856-6185878 CAGGTCCATCCTCCTGAGGGTGG - Intronic
1163218052 19:15895226-15895248 CAGGTCCATCTCCTTAAAGTTGG + Intronic
1164453119 19:28383801-28383823 CAGGTGCAAATACTTGAGGCAGG - Intergenic
1165821681 19:38680629-38680651 CAAGTCCCACTTCTTGGGCTTGG + Intronic
1166899098 19:46044487-46044509 CAGGACCAAGTTCCTGGGGTGGG + Intronic
925405636 2:3604028-3604050 CAGATCGAACTCCTTGGGGTGGG + Intronic
925500108 2:4493510-4493532 TAAGTCCAACTTACTGAGGTAGG - Intergenic
925954733 2:8952029-8952051 GAGATCTAACTTTTTGAGGTGGG + Intronic
927910991 2:26899638-26899660 AAGGGCCATCTGCTTGAGGTGGG - Intronic
928184495 2:29097408-29097430 TTAGTCCAACTTCTTGAAGTGGG - Intergenic
929012597 2:37460150-37460172 CAGATCCTACTGCTTGAGATGGG - Intergenic
931126895 2:59288302-59288324 CAAGTCCAATTTCTTGGGCTTGG + Intergenic
936400922 2:112163913-112163935 CTGGTCAAACATCCTGAGGTGGG - Intronic
936899658 2:117468843-117468865 GTGGTCCTACTTCTTGGGGTTGG + Intergenic
937377270 2:121345929-121345951 CTGGGCCACCTTGTTGAGGTGGG - Intronic
938737770 2:134202050-134202072 TAAGTCCAAGTTCTTGGGGTGGG - Intronic
938812181 2:134863579-134863601 CAGGTCCCACTCGTTGACGTGGG - Exonic
944022379 2:195122378-195122400 CAGGTCCAAATGCTTGACTTTGG - Intergenic
1170436075 20:16330704-16330726 CAGATGCAACTTATTGAGGCAGG - Intronic
1170714066 20:18817151-18817173 CAGTTCCAAATTCTTGAGAAAGG - Intronic
1170797938 20:19565939-19565961 CAGGCCCAACTTCTGTATGTTGG + Intronic
1172240314 20:33408588-33408610 CAGGTCCAGCTGCTGGAGGGTGG + Exonic
1172609610 20:36240206-36240228 CTGGTCCAGCTCCTGGAGGTTGG - Exonic
1172785636 20:37466532-37466554 CAGGGCCATCCTCTTGAGGTGGG + Intergenic
1178724379 21:35037971-35037993 CGGGGCCACGTTCTTGAGGTTGG + Intronic
1178935118 21:36855233-36855255 CGTGGCCAACTTCTTGAAGTTGG - Intronic
1181319204 22:21991640-21991662 CAGATCCAGCTTCTTCAGGCAGG + Intergenic
1182272094 22:29160762-29160784 GAGGTCTAACTTCTTGAGGTAGG - Intronic
1182837014 22:33350499-33350521 CAGATCCCACCTCTAGAGGTTGG + Intronic
1183628555 22:39019654-39019676 CAGGTCCAACTTCGAGGGGTGGG + Exonic
949476452 3:4450832-4450854 ACGGGCCAAGTTCTTGAGGTGGG + Intronic
951200201 3:19868082-19868104 CAGGAGCAAATTCTTGAGTTGGG - Intergenic
953746854 3:45581409-45581431 CAGGTGCTACTTCTTGATCTGGG + Intronic
953974023 3:47369253-47369275 CATGTCCAAAGACTTGAGGTTGG + Intergenic
961807961 3:129502773-129502795 GCTGTCCAGCTTCTTGAGGTAGG - Exonic
962478700 3:135780027-135780049 CAGGGACAGCTTTTTGAGGTAGG - Intergenic
964336317 3:155658413-155658435 CAGCTGCTGCTTCTTGAGGTTGG - Intronic
970847910 4:20564660-20564682 GAGTTCCAACTTCTTCAGGTTGG - Intronic
977563257 4:98555124-98555146 CATGTCCAACTTCGTGATCTGGG + Intronic
978627761 4:110706597-110706619 CAGGTGCAGCTTCTTGACTTTGG + Intergenic
988337113 5:29921449-29921471 CTGGTCCTACTTCTTGGGGCTGG + Intergenic
989413998 5:41152356-41152378 CAGGTCCAGGTTCTCTAGGTGGG - Intronic
991198152 5:63960007-63960029 CAAGTCCAAGTTCTAGAAGTTGG + Intergenic
992989178 5:82266437-82266459 CAGATACAACTTTTTGAGATAGG + Intronic
993439010 5:87932239-87932261 CACTTGCAACTTCTTGAGGTGGG + Intergenic
994211056 5:97087762-97087784 CAGGTCTAAGTTGTTTAGGTAGG + Intergenic
994583750 5:101680010-101680032 CAGGGCCAAAGTCTTGAGGCTGG - Intergenic
998635209 5:143946703-143946725 CATTTCTAACTTCTTGATGTAGG + Intergenic
1001450793 5:171822880-171822902 CAGGGCCACCTTCTGGAGCTGGG + Intergenic
1001826227 5:174747224-174747246 CAGTTCACATTTCTTGAGGTTGG - Intergenic
1001899501 5:175413600-175413622 CACCACTAACTTCTTGAGGTTGG + Intergenic
1004871926 6:19913788-19913810 CAGGTGCAACTTCTTGCTGCTGG + Intergenic
1007218067 6:40256688-40256710 CAGAACCAAGTCCTTGAGGTTGG + Intergenic
1015080665 6:129222121-129222143 CATGTTCAACTTCTTGGGTTGGG + Intronic
1015277300 6:131397474-131397496 CATGTCCTACTTCTTAAGCTAGG + Intergenic
1017754760 6:157519988-157520010 CAGGACAGACTTCTTGAAGTAGG + Intronic
1025992325 7:66505402-66505424 CAGGTCCTTCTTGTTGAGGAAGG + Intergenic
1028251181 7:88541561-88541583 GTGGTCCTACTTCTTGGGGTTGG + Intergenic
1032701125 7:134380232-134380254 CAGTCCCACCTTCTTGAGTTGGG - Intergenic
1032981635 7:137290693-137290715 CACCTCCAAATTCTTGAAGTTGG - Intronic
1036991740 8:13605704-13605726 CAGGTCCCACTTTCTGAGGGAGG - Intergenic
1037582721 8:20255074-20255096 CCGGTTGAGCTTCTTGAGGTGGG + Exonic
1037813532 8:22100286-22100308 CACGTACTACTTCGTGAGGTAGG + Intronic
1041047066 8:53897669-53897691 CAGGTCCAATTTCTTCAAGTTGG - Intronic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1043051202 8:75387886-75387908 TAGATCAAACTTCTTGAGGAAGG - Intergenic
1044462398 8:92460582-92460604 AAGGACAAACTTCATGAGGTTGG + Intergenic
1047715889 8:127594822-127594844 CAGGTCCAAATTCTTCAGCCTGG + Intergenic
1049801756 8:144521003-144521025 CAGGTCCAACTTCTTGAGGTGGG - Exonic
1052129546 9:24825820-24825842 TATTTCCAACTTTTTGAGGTAGG - Intergenic
1055039030 9:71848907-71848929 CAGGGTCTACTTCTTGAGGGAGG - Intergenic
1056361734 9:85864603-85864625 GAGATCTAACTTCTTGATGTAGG - Intergenic
1058872390 9:109213754-109213776 CAGTTCCAGCTTCTTTAGATGGG + Exonic
1061569075 9:131464938-131464960 CTGGTCCAGCTGCTTGAGTTTGG - Exonic
1062242558 9:135548134-135548156 CTGGTCCAAGTTCCTGAAGTGGG + Intronic
1062645021 9:137543482-137543504 CACGTCAAACTCCGTGAGGTCGG + Exonic
1187702152 X:21973142-21973164 CAGTTCCAACTCCTTGGAGTTGG - Intronic
1190523800 X:51308072-51308094 CAGATCTAACTTTTTGATGTGGG + Intergenic
1192924573 X:75741899-75741921 CAGCTCCAGCTTCTTCAGATAGG + Intergenic
1193773609 X:85617772-85617794 CTTATCCAACTTCTTTAGGTAGG + Intergenic
1195653835 X:107315338-107315360 AAGGTCCAACTCTTTGATGTTGG + Intergenic
1196017276 X:110953495-110953517 CAGATTCAACTGGTTGAGGTGGG - Intronic
1199763518 X:150924020-150924042 CTTTTCCAACTTCTAGAGGTTGG + Intergenic
1199843768 X:151675994-151676016 CAGGTGCAAGTTTCTGAGGTAGG + Exonic