ID: 1049802442

View in Genome Browser
Species Human (GRCh38)
Location 8:144524291-144524313
Sequence CAGCAGATCGTGAGGAAAAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049802439_1049802442 -1 Left 1049802439 8:144524269-144524291 CCTGCAGTCGCTGAAGTAAGGAC 0: 1
1: 0
2: 0
3: 6
4: 58
Right 1049802442 8:144524291-144524313 CAGCAGATCGTGAGGAAAAAGGG 0: 1
1: 0
2: 2
3: 7
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049802442 Original CRISPR CAGCAGATCGTGAGGAAAAA GGG Exonic
900439543 1:2646816-2646838 CAGCAGATCCTGAGGGAAGGTGG - Intronic
901916116 1:12501991-12502013 CAGCAGCACGTGTGGAAAGAAGG + Intronic
902960568 1:19960307-19960329 AGGCAGATTGAGAGGAAAAATGG + Intergenic
903035705 1:20491364-20491386 CAGCAGTGCGTGAGGACCAATGG + Intergenic
907212933 1:52838727-52838749 CAGTAGAATATGAGGAAAAAAGG + Intergenic
908050727 1:60227043-60227065 CAGCAGCTACTGAGGAAAGAAGG + Intergenic
908164849 1:61448008-61448030 CAGGAAAATGTGAGGAAAAAAGG - Intronic
908321171 1:62980433-62980455 CAACAGATTGTGAGGGAAAAAGG - Intergenic
909194630 1:72602069-72602091 CATCAGACCCTGAGGAAGAAAGG - Intergenic
910822284 1:91364297-91364319 CAGGTGATGGTGTGGAAAAAAGG + Intronic
911411860 1:97519848-97519870 CAGCAGATGGAGAAGAAAGATGG - Intronic
911418112 1:97601767-97601789 CAGCACATCGGGAAGAAAATGGG - Intronic
912047632 1:105480351-105480373 AAGCAGATAGAGAGGAAAAGGGG + Intergenic
915621008 1:157084261-157084283 CAGAAGATTTTGAGGAAAAGGGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
919224915 1:194684623-194684645 CAGTAGAGAATGAGGAAAAAAGG - Intergenic
919980230 1:202638293-202638315 CAGCATGTGGTGAAGAAAAATGG + Intronic
920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG + Intronic
921133804 1:212242492-212242514 CAGCATATCATGAGACAAAAAGG + Intergenic
922295342 1:224245212-224245234 CAACAGAAAGTGAGGAAAATTGG - Intronic
1063566346 10:7174727-7174749 CAGCAGCTCCTGAGTAAGAAAGG - Intronic
1065795820 10:29307276-29307298 CAGTAGCTGGTGAGGAAAATGGG - Intronic
1066989951 10:42503511-42503533 AAGCAGATCCAGGGGAAAAAAGG - Intergenic
1069546669 10:69334133-69334155 CAACAAATCATGAGGAAAATGGG - Intronic
1071730433 10:88243292-88243314 CAGCAGAGCTTCAGGGAAAATGG - Intergenic
1072200120 10:93150607-93150629 CAGCATATGGTAAGAAAAAAAGG - Intergenic
1073512639 10:104052209-104052231 CAGCAGCCCCTGAGGAGAAATGG + Exonic
1075487277 10:122834247-122834269 CAACAAATTGTAAGGAAAAAAGG + Intronic
1075758596 10:124837578-124837600 AAGCAGATCCTAATGAAAAAAGG - Intergenic
1076702972 10:132283821-132283843 CAGCAGAGCGTGGGGAGAAGTGG - Intronic
1078022497 11:7667474-7667496 CAGTACATCTTAAGGAAAAAAGG + Intronic
1078631015 11:13004462-13004484 AAGTAGATGGTGATGAAAAACGG + Intergenic
1079694991 11:23470767-23470789 CATCAGAGAGTAAGGAAAAAAGG - Intergenic
1083557933 11:63647063-63647085 GAGCAGATCATGAGGAAATTTGG - Intronic
1083769573 11:64858980-64859002 AAGCAGCTCGTGAGGAGACAGGG - Intronic
1085117714 11:73944993-73945015 CAGCTGATCCTGAGGGTAAAGGG + Intergenic
1085410047 11:76285501-76285523 CAGCAGATCCCTAGGGAAAATGG - Intergenic
1087583982 11:100094700-100094722 AAGCAGACCAGGAGGAAAAAAGG + Intronic
1089165938 11:116476614-116476636 AAGCAGTTGGTGAGGAAAGAAGG + Intergenic
1089795216 11:120974793-120974815 CGGCAGATCCTGTGGAAAACTGG + Intronic
1093116626 12:15220194-15220216 CAGCAGAACATTAGGACAAATGG - Intronic
1093211832 12:16317326-16317348 CAGTAGATCATCAGGCAAAAAGG + Intergenic
1101906084 12:108827563-108827585 CAGCACATCCTGATGAAAGAGGG + Intronic
1104490469 12:129189459-129189481 CTGCACATGGTGAGGAAAGAGGG + Intronic
1105069555 12:133226419-133226441 CAGAGGAACGTGAGGAAAAGGGG - Exonic
1105612234 13:21978345-21978367 GAGCAGATGGTGAGAAAAAGGGG + Intergenic
1107436915 13:40388504-40388526 TAGCAGAGCCTGAGGCAAAAGGG - Intergenic
1107899424 13:44997213-44997235 CAGCAGAGTGTGAGGAACACAGG - Intronic
1108113016 13:47097553-47097575 CAGGAGATGGTGAAGCAAAAAGG + Intergenic
1108528207 13:51303653-51303675 CAGCAGCTCTTGATTAAAAAGGG + Intergenic
1109856514 13:68135545-68135567 CAACAAATTGGGAGGAAAAAAGG - Intergenic
1111801009 13:92980840-92980862 CAGAAGACAGAGAGGAAAAAAGG - Intergenic
1112124269 13:96447413-96447435 CGGCAGATAGTTAGGAAAAGGGG + Intronic
1114714527 14:24810577-24810599 AAGCAGAGAGTGAGGAAAGAGGG + Exonic
1115012163 14:28562053-28562075 CTGAAGACAGTGAGGAAAAAGGG + Intergenic
1116301076 14:43184426-43184448 AGGCAGATAGAGAGGAAAAAGGG + Intergenic
1116543835 14:46136770-46136792 CAGCACTTCCAGAGGAAAAAAGG + Intergenic
1117729064 14:58703398-58703420 CAGCACATTTTGAGGAACAAAGG + Intergenic
1120270378 14:82306366-82306388 CAGATGATCCTGAGGAAAGATGG - Intergenic
1120425381 14:84341263-84341285 AAGCAGATAGAGAGGAAAAGGGG + Intergenic
1121439621 14:93940470-93940492 CACGAGATCCTGAGGACAAAAGG + Intronic
1121760437 14:96440412-96440434 GAGCAGAGGGTGAAGAAAAAAGG - Intronic
1122720520 14:103719496-103719518 CAGTTGATCATGAGGAGAAATGG + Intronic
1124621105 15:31274534-31274556 CAGCTGATGTTGAGGAAACATGG + Intergenic
1127166700 15:56251172-56251194 CAGGAGATGGTAAGGGAAAAAGG - Intronic
1128804511 15:70520783-70520805 CAGCAGAGCATGAGGAGAAGGGG + Intergenic
1129380102 15:75159194-75159216 CAGCACATGGTGAGAATAAAAGG - Intergenic
1131206065 15:90448559-90448581 CAGAAAATGCTGAGGAAAAAAGG - Exonic
1133735757 16:8614367-8614389 CAGGAGATGGGGAGGAAGAAGGG + Intergenic
1133865778 16:9641793-9641815 CAGAAGCTCAAGAGGAAAAAAGG + Intergenic
1134201011 16:12198922-12198944 CAACAGAACATGAGGACAAAGGG - Intronic
1140239503 16:73188443-73188465 CATCAGCTCGAGAGGACAAAGGG - Intergenic
1141800082 16:86301628-86301650 CATCAGAGCGTAAAGAAAAAAGG + Intergenic
1144293241 17:13846790-13846812 CAGCAAATAAGGAGGAAAAAAGG - Intergenic
1144476616 17:15594572-15594594 GAGAAGATGGTGGGGAAAAATGG + Intronic
1144921636 17:18768830-18768852 GAGAAGATGGTGGGGAAAAATGG - Intronic
1145847189 17:28050767-28050789 CAGAAGATTGTTAGGAAAATGGG + Intronic
1148197359 17:45723722-45723744 CAACAGAATGTGAGCAAAAAGGG - Intergenic
1148537347 17:48451282-48451304 GAGCAGATCTGGAGGAGAAAGGG - Intergenic
1149207718 17:54267561-54267583 AGGCAGATAGAGAGGAAAAAAGG - Intergenic
1152266993 17:79301007-79301029 GAGGTGATGGTGAGGAAAAAGGG - Intronic
1156478582 18:37421939-37421961 CAGCAGAATGTGAGCAAACACGG + Intronic
1156680741 18:39585687-39585709 CAGGAGATGGTGAGACAAAAGGG + Intergenic
1157748444 18:50157603-50157625 CAGCAGCTAGTGAGGAAAAAGGG - Intronic
1158089706 18:53696481-53696503 AAGCAGATCTTAATGAAAAATGG - Intergenic
1158812378 18:61052597-61052619 CAACAGATGGTGGGGAGAAAAGG + Intergenic
1159347608 18:67227249-67227271 CAACAGAATGTGAGGGAAAAGGG - Intergenic
1167552471 19:50170392-50170414 CAGCACACCGTGAGGATGAAAGG - Intergenic
927139458 2:20119822-20119844 CAGCAGCTGCTGAGGAAAAGGGG - Intergenic
928804805 2:35138110-35138132 CAGCAGATCTTAATGACAAAAGG - Intergenic
931591022 2:63883409-63883431 CAGCAGAGTGTGAAGAAAACAGG - Intronic
931945862 2:67306555-67306577 CAGCAGATTGAGAAAAAAAATGG - Intergenic
932425955 2:71635341-71635363 CAGCAGAATGTGGGGAAAGAGGG - Intronic
932557718 2:72840210-72840232 CAGGAGATCATGAGGCTAAAGGG - Intergenic
934166173 2:89296294-89296316 AGGCAGATAGAGAGGAAAAAAGG - Intergenic
934201102 2:89886162-89886184 AGGCAGATAGAGAGGAAAAAAGG + Intergenic
937600739 2:123728541-123728563 CAGCATCTCGTGAAGAATAAAGG - Intergenic
940771587 2:157844698-157844720 CAGCAGCTCTTGAGGTCAAAAGG - Intronic
940881731 2:158953558-158953580 CAGCAGATTCTGATGAAAAAAGG - Intergenic
943618411 2:190119679-190119701 AGGCAGATAGAGAGGAAAAAAGG - Intronic
947267598 2:228300381-228300403 AGGCAGATAGAGAGGAAAAAAGG - Intergenic
947268789 2:228309403-228309425 AGGCAGATAGAGAGGAAAAAAGG - Intergenic
948207493 2:236169932-236169954 CAGCAGACCTGGAGGAAAGAGGG + Intergenic
949048932 2:241886736-241886758 CTGCAGAGAATGAGGAAAAATGG + Intergenic
1170513622 20:17105213-17105235 CAGCAGATCTTCAGGAGACAGGG - Intergenic
1170990113 20:21293289-21293311 AAGCAGATATTTAGGAAAAATGG + Intergenic
1171488290 20:25499166-25499188 CAGCAGCTCCTGAGGAGCAATGG + Intronic
1173756866 20:45524507-45524529 CAGCAGATGCTGAAGAAAATGGG - Intergenic
1175452699 20:59083665-59083687 CAGCAGAGCGGCAGGAGAAAGGG + Intergenic
1178948159 21:36965641-36965663 CAGAAGATGGAGAGGGAAAAGGG + Intronic
1180881640 22:19208263-19208285 CTGCAGATGGCCAGGAAAAAGGG - Exonic
1182499629 22:30736996-30737018 CAGAAGTTCCTGTGGAAAAATGG - Intronic
1182931217 22:34176093-34176115 CAGCAGGTGGTGGGGCAAAAAGG + Intergenic
1183343236 22:37293670-37293692 CTGCAGATCCTGGGGAGAAAGGG + Intronic
1185122519 22:48980897-48980919 CAGCAGATCTGGAGGAAATATGG - Intergenic
952872737 3:37916214-37916236 TAGCAGGTAGTGAGGAATAATGG - Intronic
952934094 3:38382100-38382122 CAGCCGATGCTTAGGAAAAATGG + Intronic
953199784 3:40768477-40768499 CAGAATGTCTTGAGGAAAAAAGG + Intergenic
954401748 3:50322813-50322835 CAGCAGGAAGTGAGGAGAAAGGG - Intronic
955507242 3:59644725-59644747 CAGCATACTGTGAGGACAAATGG + Intergenic
957223343 3:77412455-77412477 CAGTAGATCTTGAGGACAGAGGG - Intronic
957477640 3:80747402-80747424 CAACAGATTGTGGGGATAAAAGG - Intergenic
959780684 3:110229512-110229534 CAGAAGATCCAGAGGAAGAAGGG - Intergenic
959952617 3:112197015-112197037 CAGCAAATTCTGGGGAAAAAGGG - Intronic
963754125 3:149215662-149215684 CAGCACAGCTTGAGGACAAAGGG + Intronic
964373402 3:156025488-156025510 CAGAAGATTGTAAGGAAAGAAGG + Intergenic
964604390 3:158544196-158544218 AAGCTGATGCTGAGGAAAAATGG + Exonic
967875860 3:194268104-194268126 CAGCTGAGCGTGAGAAGAAAGGG - Intergenic
968663187 4:1807201-1807223 CAGCAGGTCGTGGGCAAACACGG - Exonic
968669771 4:1842911-1842933 CAGGAGATCGTGAGGCTGAATGG - Intronic
969560738 4:7946169-7946191 CAGCAGCTGGTGAGAAAATATGG - Intergenic
970592345 4:17570405-17570427 CTGCAGATAGAGAGGAAAAGGGG - Intergenic
970925565 4:21447762-21447784 CAGCAGATCACAAGAAAAAAAGG - Intronic
971653243 4:29306958-29306980 AAGCAGATAGTGAGGAGACAGGG - Intergenic
971779137 4:31008125-31008147 CAGCAGCTGGAGAGGAGAAAAGG + Intronic
972023647 4:34348297-34348319 TGGCAGATCTTTAGGAAAAAAGG - Intergenic
973232043 4:47851446-47851468 CAGCAACTCAAGAGGAAAAAAGG - Intronic
980763642 4:137270200-137270222 CAGAAGATAGAGAGCAAAAAGGG + Intergenic
981580885 4:146247449-146247471 CAGAAGATGTAGAGGAAAAAGGG + Intergenic
982699305 4:158641545-158641567 GAGCAGAACATGAGGAAAGAAGG - Intronic
982716163 4:158810846-158810868 GAGCAGAACTTGAGGAAAAAAGG - Intronic
987100671 5:14588783-14588805 CAGCTAATAGGGAGGAAAAAGGG + Intronic
993061704 5:83046419-83046441 TAGGAGAGCGGGAGGAAAAAAGG + Intergenic
993247002 5:85464166-85464188 AGGCAGATAGAGAGGAAAAAGGG + Intergenic
994914596 5:105958136-105958158 CAGCAGATGGTGAGAAAAAAAGG + Intergenic
995063532 5:107836823-107836845 CACCAAAACGTGAGGAAACAGGG + Intergenic
996773785 5:127112629-127112651 CAGCAGAGACTGAGGAGAAAAGG + Intergenic
998970707 5:147588968-147588990 CAACAGAAAGTGAAGAAAAATGG + Exonic
1000307841 5:160012023-160012045 CACCAGAACAGGAGGAAAAAGGG + Intronic
1004126769 6:12881831-12881853 CAGCAGAGAGTGAGAAAGAAGGG + Intronic
1006257899 6:32845625-32845647 CAGCAGCTCATGGAGAAAAAGGG - Exonic
1007917426 6:45574242-45574264 CACCAGCTTGTGAGAAAAAATGG - Intronic
1009860103 6:69317704-69317726 CAGAAGATTCTGAGGAAAGAAGG - Intronic
1010049380 6:71484929-71484951 AAGCAGAGAGTCAGGAAAAATGG + Intergenic
1013760370 6:113510960-113510982 CAGCAGGGGGTGAGGAAAGAGGG + Intergenic
1017887423 6:158610608-158610630 CAGAAGCTCGGGAGGAAAAGAGG - Intronic
1018225250 6:161622166-161622188 CAGCAGCTGGTGAGGAATAGAGG - Intronic
1020651480 7:10882071-10882093 TAGCAGATAGAGAGGAAAAGGGG + Intergenic
1020868375 7:13594876-13594898 AAGCAGAAAGAGAGGAAAAAAGG - Intergenic
1020946401 7:14613753-14613775 CAGCAGAATTTGAGGAAAAAGGG + Intronic
1021115871 7:16745957-16745979 CAGCAGAATCAGAGGAAAAATGG + Intergenic
1021276861 7:18662708-18662730 CAGCAGGGAGTGAGGAAAAGGGG + Intronic
1021574709 7:22096571-22096593 AGGCAGATAGTGAGGAAAAGGGG + Intergenic
1021667408 7:22998691-22998713 CAGCAGATGCAGAGGAAATAAGG - Intronic
1021946547 7:25733202-25733224 AGGCAGATAGAGAGGAAAAAAGG - Intergenic
1025638858 7:63349284-63349306 CTGCAGATCCTGAGGAAGGAGGG - Intergenic
1025643841 7:63398808-63398830 CTGCAGATCCTGAGGAAGGAGGG + Intergenic
1027141829 7:75662997-75663019 CAGCAGTTCATGTAGAAAAAAGG - Intronic
1028116233 7:87001139-87001161 CAGCTGATTGTGAGGAAGAAAGG + Intronic
1029413152 7:100428030-100428052 CGACAGATTCTGAGGAAAAAGGG + Intronic
1036138159 8:6181096-6181118 CCGCAGACAGCGAGGAAAAAGGG + Intergenic
1039255381 8:35712907-35712929 CAGCAGGAGATGAGGAAAAATGG - Intronic
1044808491 8:96033088-96033110 AAGCAGATAGAGAGGAAAAGGGG - Intergenic
1046077723 8:109333348-109333370 TAGAAGATAGTGAGGAAAAGTGG - Intronic
1046956289 8:120066052-120066074 TAACAGATTGTGAGTAAAAATGG - Intronic
1047398687 8:124527709-124527731 CAGCAGATCGTGGCTAAAATGGG - Intronic
1047792548 8:128219112-128219134 GAGCAGACAGTGAGGACAAATGG + Intergenic
1049307243 8:141910605-141910627 CAGCAGCTCCTGAGGCACAAGGG + Intergenic
1049802442 8:144524291-144524313 CAGCAGATCGTGAGGAAAAAGGG + Exonic
1056074118 9:83020852-83020874 CAGCAGATGGAGAGAAAAAAAGG + Intronic
1062630118 9:137459578-137459600 CAGCAGATCGTGAGGGCCGAGGG - Intergenic
1187368392 X:18683355-18683377 TAGCAGATATTGAGGAAAAGAGG + Intronic
1188984949 X:36760888-36760910 CAGCAGAGCGTGAGTGAAGAGGG - Intergenic
1189943964 X:46157859-46157881 CCTCAGATCATGAGGAAGAATGG - Intergenic
1192124272 X:68487123-68487145 CAGTTGATTGTGAGGAGAAATGG + Intergenic
1197849405 X:130841612-130841634 CAGCAGATGGTTAAGAAAAGAGG + Intronic
1198410457 X:136362135-136362157 CAGCAGAGAGTGAGAAAAGAGGG - Intronic
1198984361 X:142432169-142432191 CTGCAGAGCATGAGGAGAAAAGG - Intergenic
1200140738 X:153901780-153901802 CAGGAGATAGGGAGGAACAACGG - Intronic
1200363979 X:155641657-155641679 TATCAGATCTTGAGGAAAACCGG + Intronic