ID: 1049802872

View in Genome Browser
Species Human (GRCh38)
Location 8:144526383-144526405
Sequence CCTTCCTGGGGGAGGCTGAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 1, 2: 4, 3: 58, 4: 413}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049802872_1049802880 -5 Left 1049802872 8:144526383-144526405 CCACTCAGCCTCCCCCAGGAAGG 0: 1
1: 1
2: 4
3: 58
4: 413
Right 1049802880 8:144526401-144526423 GAAGGCTTCTCAAGTGGAGAAGG 0: 1
1: 0
2: 1
3: 18
4: 228
1049802872_1049802882 17 Left 1049802872 8:144526383-144526405 CCACTCAGCCTCCCCCAGGAAGG 0: 1
1: 1
2: 4
3: 58
4: 413
Right 1049802882 8:144526423-144526445 GTTCTTGGCCTCAGAACTCACGG 0: 1
1: 0
2: 1
3: 18
4: 181
1049802872_1049802881 2 Left 1049802872 8:144526383-144526405 CCACTCAGCCTCCCCCAGGAAGG 0: 1
1: 1
2: 4
3: 58
4: 413
Right 1049802881 8:144526408-144526430 TCTCAAGTGGAGAAGGTTCTTGG 0: 1
1: 0
2: 1
3: 10
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049802872 Original CRISPR CCTTCCTGGGGGAGGCTGAG TGG (reversed) Exonic
900199909 1:1399776-1399798 TCATCCAGGGGGAGGCCGAGCGG - Intronic
900244447 1:1630872-1630894 CCGTCCTGGGGGCGGCCGCGGGG + Intergenic
900360020 1:2283927-2283949 CCTTCCTGCAGGAGGCGGGGAGG + Intronic
900601080 1:3502885-3502907 CCTCGCTGGGGGAGGCAGGGAGG - Intronic
900641637 1:3690469-3690491 CCTGCCTGGGGAAGGCTCGGGGG - Intronic
901152323 1:7112100-7112122 CCTTTGTAGGGGAGGCTGTGTGG + Intronic
902400327 1:16153819-16153841 TCTGCCTGGGGGTGGCTTAGGGG - Intronic
902544166 1:17176423-17176445 CCTTTCCAGGGAAGGCTGAGTGG + Intergenic
902681283 1:18045715-18045737 CGCTCCTGGGGGAGTCTCAGGGG - Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903283862 1:22265097-22265119 ACTTCCTGGGAGAAGGTGAGAGG + Intergenic
903422847 1:23231134-23231156 CCAATCTGGAGGAGGCTGAGGGG - Intergenic
903443874 1:23408348-23408370 CCTTCCCTGGGGTGGCTGACTGG - Intronic
903542100 1:24102251-24102273 CCTCCCTGTGGGAGGTTTAGCGG - Intronic
903676418 1:25067375-25067397 GCTTCCTGGAGGAGGTGGAGCGG - Intergenic
903868005 1:26412222-26412244 CATTCCTGGGCCAGGCTGGGAGG + Intronic
905238267 1:36565349-36565371 CCTTCCTGGGGGTGGCAGGCAGG + Intergenic
905316397 1:37084229-37084251 GCGCCCTGGGGGAGGCTGGGGGG + Intergenic
905658600 1:39702566-39702588 TCTTCCTGGGAGAGTCTGTGGGG + Intronic
906143049 1:43545080-43545102 CCTCCCTGGGGCTGGCTCAGGGG - Exonic
906210697 1:44010939-44010961 CCCTGCTGGGGGAGGCCCAGAGG - Intronic
907357693 1:53889822-53889844 TCTTCCCGGAGGAGGCGGAGAGG - Intronic
909293044 1:73908900-73908922 CCTTTTTGGGGCAGGCTGGGGGG - Intergenic
909657268 1:78045888-78045910 CCATCCCGGGGGAGGCTGGGCGG + Exonic
909942757 1:81630256-81630278 CTTTCCTGGAGAAGGCTGGGAGG - Intronic
910365475 1:86460441-86460463 CATTCCTGGTGGAGGGTGGGGGG + Intergenic
911091776 1:94022893-94022915 AGTTCCTGAGGGAGGCTGGGAGG + Intronic
912392968 1:109317567-109317589 CCTTCCTGGGGGTGGTTGGGCGG + Intronic
912576069 1:110674183-110674205 GCTTCCTGCGGGAGGAGGAGCGG - Exonic
913146012 1:115990718-115990740 CCATTCTGGGTAAGGCTGAGAGG - Intronic
915524491 1:156467606-156467628 TCTTCATCAGGGAGGCTGAGAGG + Exonic
915955012 1:160213938-160213960 CCTTCCAGGTGGGGGTTGAGTGG - Exonic
916501724 1:165393163-165393185 CCTCCCCTGGGGAGGCTGGGCGG + Intergenic
919939704 1:202277843-202277865 GCTTCCTGGGGGAGGTGGGGTGG + Intronic
920370035 1:205473075-205473097 TCTTCCTGTGGGAGGAGGAGGGG - Intergenic
920673677 1:208024196-208024218 TCATCTTGGGGGAGGCAGAGAGG - Exonic
920679413 1:208060897-208060919 CCTCCCTGGGGGAGGGGGAAGGG - Intronic
922492020 1:226025531-226025553 CCTTTCTGGGGGTGGCAGGGAGG + Intergenic
922696318 1:227732833-227732855 CCCTCCTGGGGGAGGCTTTTAGG - Intronic
923335774 1:232968911-232968933 CCTTCCTGGGGAAGGCTGACAGG - Intronic
923402122 1:233625476-233625498 CTAGCCTGGGGGAGGATGAGGGG + Intronic
923624075 1:235599965-235599987 ACTTCCTGGGGTAGGCTGGTGGG - Intronic
923663798 1:235981068-235981090 CCTTCAAGGAGGAGGCTGAGTGG + Intronic
924038350 1:239958214-239958236 CATTGCTGGAGGAGGCTGTGTGG - Intergenic
1063960041 10:11299454-11299476 CCTTCCTGGGGGGGGTTGGGGGG - Intronic
1065789857 10:29250686-29250708 CCTTCTTGGGGGATGATGACTGG - Intergenic
1067551363 10:47238628-47238650 CCTTCCTGGGTGGTGCAGAGTGG - Intergenic
1070780782 10:79136313-79136335 ACTTCCTGGGACAGGCTGGGGGG - Intronic
1070792605 10:79198427-79198449 CCTGCCTGGGGAAGGAGGAGGGG - Intronic
1071464035 10:85923379-85923401 CAGCTCTGGGGGAGGCTGAGAGG + Intronic
1071542499 10:86499761-86499783 GCTTTCTGGGGGAGGCTGCAAGG + Exonic
1071584803 10:86809689-86809711 CAATACTTGGGGAGGCTGAGGGG - Intronic
1072026509 10:91464798-91464820 CCATGCTGGGGTAGGCTGAGTGG - Intronic
1072609006 10:97004397-97004419 ACTCCCTGGGGAAGGCTGAGAGG + Intronic
1073069774 10:100785957-100785979 CCTTCCTGGGGGCTGTGGAGAGG + Intronic
1073328407 10:102656001-102656023 CCAGCCTGGGGGAGGCTCAGGGG + Intronic
1073374482 10:103021233-103021255 CCTTCGTCAGGGAGGCTGTGGGG - Intronic
1073814018 10:107185742-107185764 CCTTGAGGGTGGAGGCTGAGAGG + Intergenic
1074298234 10:112210612-112210634 CTTTCCTGGGTGGGGTTGAGGGG - Intronic
1075651796 10:124132191-124132213 CCTTCCTGGGGGGAGCTGGGAGG + Intergenic
1075790987 10:125084435-125084457 CCCTCCTGGGGTAGGCACAGAGG - Intronic
1075930422 10:126290271-126290293 CCTTCTTGGTGGAGGCTCTGGGG - Intronic
1076362455 10:129898846-129898868 CCTTGCTGCGGGAGGCGCAGCGG - Intronic
1076373824 10:129970882-129970904 CCTTCCTGGGGGGAGAGGAGGGG - Intergenic
1076384541 10:130046870-130046892 CCTTTCTGGGGGTGACAGAGTGG + Intergenic
1076727890 10:132421829-132421851 CCTTCCTGGGTGTGGCTGGGGGG + Intergenic
1076796668 10:132801684-132801706 GCTTCCCTGGGGAGGCTGAAGGG - Intergenic
1076847637 10:133077108-133077130 CCTTCCTGGGCTGGGCTGGGTGG - Intronic
1076859613 10:133134467-133134489 CCTGTCTGGGAGAGGCTGGGGGG - Intergenic
1076864467 10:133160203-133160225 CCTTCCTGGGGGAGGCACCGGGG - Intergenic
1077156117 11:1092482-1092504 CCATCCTGGGGAAGCCTGTGGGG + Intergenic
1077212948 11:1382000-1382022 CCTTGCTGGGGGTGGCAGGGGGG - Intergenic
1077366831 11:2164641-2164663 GCTTCCTGGAGGAGGCCCAGTGG - Intronic
1077998463 11:7474124-7474146 CCTTCCTGAAAGTGGCTGAGGGG + Intergenic
1079108261 11:17588115-17588137 CCTTCATAGGAGAGGCTGACTGG + Intronic
1081672430 11:44949688-44949710 CCTACCCGGGGGAGGCTGTGTGG - Intronic
1083669621 11:64292574-64292596 CCCTCGAGGAGGAGGCTGAGGGG - Intronic
1083804767 11:65067160-65067182 CCTTCCAAGGGGAGCCTCAGAGG - Intronic
1083826857 11:65208839-65208861 GCCTCCTGGGCCAGGCTGAGTGG + Intronic
1084172441 11:67407002-67407024 CCTTCCTCAGTGAGGGTGAGTGG + Exonic
1085052124 11:73385211-73385233 CCTGCCTAGGGGAGGGGGAGTGG + Intronic
1085354445 11:75822905-75822927 CCTTCCTGGAGGATGGGGAGTGG + Intronic
1087188677 11:95230684-95230706 GCGCACTGGGGGAGGCTGAGAGG - Intronic
1088817504 11:113431896-113431918 CCTGCCTGGGGCAGCCTGGGTGG - Intronic
1089344488 11:117782053-117782075 CCTTCCTGGTGGAGAGAGAGTGG - Intronic
1089556289 11:119317330-119317352 CCTGGCTTGGGAAGGCTGAGGGG + Intronic
1089586663 11:119513799-119513821 CCCTCCTGGGGGAGGAGGGGTGG + Intergenic
1089697268 11:120223836-120223858 CCTTCCTGGGGGATCCTGCCAGG + Intronic
1089768214 11:120783974-120783996 CCAGCCTCAGGGAGGCTGAGGGG + Intronic
1091269797 11:134300028-134300050 CCTTTCTGGTGCTGGCTGAGGGG - Intronic
1092052736 12:5484042-5484064 GTTTCCTGGGGGAGGCACAGGGG - Intronic
1092532003 12:9352628-9352650 CCTTCTTGGGGGAGGGGGAGAGG - Intergenic
1095435809 12:42186427-42186449 CTTTCCTGAGGGGGGCAGAGGGG + Intronic
1096156260 12:49342955-49342977 CCTCCCGGCGGGAGGCAGAGGGG + Intergenic
1096532739 12:52252211-52252233 ACTGCCTGGGGGAAACTGAGGGG + Intronic
1096670220 12:53194048-53194070 CCTTCCTGGAGCAGTCTGAGTGG - Exonic
1096716830 12:53496453-53496475 CCTCCATGGGTAAGGCTGAGGGG - Intronic
1098521508 12:71439573-71439595 TCTTCCAGGCGGAGGCTCAGTGG + Intronic
1101441592 12:104708322-104708344 CCTTCCCGGGGGCGGCTGTGGGG + Intronic
1103362288 12:120361495-120361517 CCCTCCTGGGGCGAGCTGAGGGG + Intronic
1103727266 12:123004340-123004362 CCTTCCTGGGCGAGGTGGGGAGG - Intronic
1104472951 12:129045324-129045346 CCCTCCTGGGGGTGGCCTAGAGG - Intergenic
1104498024 12:129259106-129259128 CCTTACTGAGGGCGGCTGAAAGG - Intronic
1104846294 12:131848757-131848779 CCTTCCTGGCTGAGGCTGAGCGG + Intronic
1104943219 12:132404484-132404506 CCTCCCTGGTGGATCCTGAGGGG + Intergenic
1105407674 13:20145460-20145482 CCCTCCTGGGGGTGACTGGGTGG - Intronic
1105533599 13:21243283-21243305 CCTTCCTGGAGGAGCCATAGGGG + Intergenic
1106316779 13:28601189-28601211 CCTTCATGGGGGTGGGGGAGGGG + Intergenic
1107561458 13:41560853-41560875 CCTTCTCGGGGGAGTCTTAGAGG - Intergenic
1110817321 13:79876396-79876418 GCTTCCTCAGGGAGGCTCAGAGG - Intergenic
1111300422 13:86342238-86342260 GCTTCCTGGGGTTGGCAGAGGGG + Intergenic
1112006581 13:95258932-95258954 CCTGCCTGCGGGAGGCTGCTGGG + Intronic
1112271750 13:97976027-97976049 CCTTCCTGGGGGTGGGTGAAGGG + Intronic
1113462400 13:110491357-110491379 CCTGCCTGAGGAAGGCTGTGTGG - Intronic
1113888423 13:113724076-113724098 CCTGCCTGGGGGGAGGTGAGAGG - Intronic
1114212712 14:20628998-20629020 CCTTGATGAGGGAGGCTGTGGGG - Intergenic
1114287895 14:21262593-21262615 CCTTCCTGGGTGATGGTAAGAGG - Intronic
1118468906 14:66056815-66056837 CCTTCCTCTGGGGGGCTGGGTGG - Intergenic
1118827236 14:69395063-69395085 TCATCCTCTGGGAGGCTGAGAGG + Intronic
1118892426 14:69921343-69921365 CCTTCCCAGGGGAGGCTGTTAGG + Intronic
1120309005 14:82806594-82806616 ACTCCCTGTGGGAGGCTAAGGGG - Intergenic
1121642982 14:95498813-95498835 CCAGCCTGGGGGGGACTGAGAGG - Intergenic
1121645475 14:95515175-95515197 CCCCTCTGGGGGTGGCTGAGCGG - Intergenic
1121675152 14:95746482-95746504 CCTGCCTAAGGGAGGATGAGAGG - Intergenic
1122415872 14:101549221-101549243 CCCTCCTCGGGGACGCTGTGGGG - Intergenic
1122718951 14:103711692-103711714 CCTTCCTGGGAGAGGCTGGGTGG - Exonic
1123006348 14:105325637-105325659 GCATCCTGGGGAAGGCTGAAGGG - Intronic
1124252762 15:28117723-28117745 CCTGTGTTGGGGAGGCTGAGTGG - Intronic
1124512767 15:30340703-30340725 CCCTCCTGATGCAGGCTGAGGGG - Intergenic
1124634687 15:31357526-31357548 CCTGCCTGGGGGAGGGAGGGTGG + Intronic
1124730148 15:32190047-32190069 CCCTCCTGATGCAGGCTGAGGGG + Intergenic
1127453497 15:59138328-59138350 CCCTGCTGGGGGAGGCCGACTGG + Exonic
1128520993 15:68374809-68374831 CCTTGCAGAGGGAGGCTGTGAGG - Intronic
1128850458 15:70949959-70949981 ACTTGATGGGGGAGGGTGAGGGG - Intronic
1129166258 15:73779848-73779870 CCATCCTGGGGGTGGGTGATGGG + Intergenic
1129269878 15:74413980-74414002 CCCTGCTGGGGGAAGCTGGGTGG - Intronic
1129298021 15:74610403-74610425 CCTGCTAGGAGGAGGCTGAGTGG + Intronic
1129626804 15:77209664-77209686 CCTTTCTGTGAGATGCTGAGAGG + Intronic
1129694537 15:77733175-77733197 CCATCCTGTGGGTGGCTGAGTGG - Intronic
1129974877 15:79813533-79813555 CATTGGTTGGGGAGGCTGAGTGG + Intergenic
1131075065 15:89490293-89490315 GCTACCTGGAGGAGGCTTAGGGG + Intronic
1131430335 15:92383037-92383059 CTTTCTTGGGGGAGGAGGAGGGG - Intergenic
1131558266 15:93417896-93417918 CCCTCCCGGGGCAGGCTGGGAGG + Intergenic
1132530480 16:445844-445866 GCTCCCTGGGGGAGGCAGATGGG + Intronic
1132544030 16:524875-524897 CCATCCGGGGGGCCGCTGAGGGG - Intergenic
1132547463 16:539965-539987 GCCGCCTGGGGTAGGCTGAGGGG - Intronic
1133071541 16:3249732-3249754 CCTTCCTGGGCGTGGCAGCGGGG + Exonic
1133124553 16:3637535-3637557 CCTGCCTGTGGAAGGCTTAGGGG + Intronic
1135086599 16:19479504-19479526 CCTTCCTGGGGGAGTTTCTGAGG + Exonic
1135135960 16:19885396-19885418 CCTGCCTGGAGGAGGCCTAGCGG - Intronic
1135768393 16:25197605-25197627 TACGCCTGGGGGAGGCTGAGAGG - Intergenic
1135915325 16:26600418-26600440 ACTTCTTGTGGGAGGATGAGTGG + Intergenic
1136278048 16:29191177-29191199 CCTTCCTGAGAGAGCCTGTGAGG - Intergenic
1137399012 16:48138121-48138143 CATTCCAGAAGGAGGCTGAGGGG - Intronic
1137646999 16:50084232-50084254 ACTTCATGGGAGAGGCAGAGGGG - Exonic
1137669382 16:50270640-50270662 CCTCCCTGGGGGAGCCTGGGTGG + Intronic
1137753984 16:50887055-50887077 CCTCCCTGGGGGAGGTGGTGGGG + Intergenic
1138532963 16:57645247-57645269 CCTCGCTGGGAGAGGCAGAGGGG - Intronic
1138607454 16:58098182-58098204 CCTTCATGGGGGCAGGTGAGAGG - Intergenic
1139360731 16:66398141-66398163 CCACCCTGGGGCAGGCTGGGGGG + Intronic
1139543817 16:67639207-67639229 CCTGCTTGAGGGAGGCTGGGGGG + Intergenic
1140475836 16:75238876-75238898 CCTGCCTTTGGGAGGCTGGGAGG - Intronic
1140872153 16:79116689-79116711 CCTTCTTGGGTGACTCTGAGGGG - Intronic
1141121043 16:81356905-81356927 CCTTGCTGCGGCTGGCTGAGCGG - Exonic
1142078800 16:88136201-88136223 TCTGCGTGGGGGAGGCTGTGAGG + Intergenic
1142082424 16:88157217-88157239 CCTTCCTGAGAGAGCCTGTGAGG - Intergenic
1142119067 16:88377041-88377063 CCCTCCTGGGAGATGCTGAAGGG - Intergenic
1142412024 16:89921747-89921769 CCTTCCTGGGACAGGCTCAATGG + Intronic
1142957076 17:3529563-3529585 CCTTCCTGGAGGAGGCTAGAGGG - Intronic
1143404793 17:6670143-6670165 CCTTGCTGGTGGAGGGTGAATGG - Intergenic
1143544738 17:7589365-7589387 CCTTCGTGGAGGAGGCCAAGCGG - Exonic
1144649182 17:16996870-16996892 AACTCCTCGGGGAGGCTGAGCGG - Intergenic
1144674367 17:17152525-17152547 GCTTCCTGGGGGAGGCTTCCTGG + Intronic
1145031351 17:19507496-19507518 CCTGGCTGGGGGCGGCTGGGCGG - Intronic
1146226187 17:31068408-31068430 CTTTCCTGGCTGAAGCTGAGTGG + Intergenic
1147677676 17:42219129-42219151 CCTTCCTGGGGGAGGTGCACAGG + Intronic
1147688360 17:42300442-42300464 CCTTCCTGGGGGAGGTGCACAGG - Intronic
1147882220 17:43661302-43661324 TCCTCCTGGGGCAGGCTGTGTGG + Exonic
1148847701 17:50538889-50538911 CGTCCCTGTGGGAGGCTGGGGGG - Exonic
1149624394 17:58069846-58069868 CCTTCCTGCTAGAGGCTGAGTGG + Intergenic
1150429881 17:65106542-65106564 CTGTACTGGGGGATGCTGAGAGG - Intergenic
1150572979 17:66404369-66404391 CCTTCATGGGGGCGGCGGAGGGG + Intronic
1150621917 17:66814158-66814180 CCTTCCTGGGGGAGGAGGCAGGG + Intergenic
1150816571 17:68396688-68396710 GTTTGCTGGGGGAGGCTGGGTGG - Intronic
1151054196 17:71012863-71012885 CCTTCCTGGTGGAGGCCATGGGG + Intergenic
1151155868 17:72122745-72122767 CCTTCGTGGAGGAGGCGGAGCGG + Exonic
1151193542 17:72415769-72415791 CCTCCCTCTGGGAGGGTGAGAGG + Intergenic
1151670968 17:75571560-75571582 CCCTCCTGGGAGAGGCTGGAAGG - Intronic
1151830610 17:76547200-76547222 CCTTCCTGAGGAAGACTGAGGGG - Intronic
1151896631 17:76985166-76985188 CCTTCCTTGGCCAGGCTCAGTGG - Intergenic
1151924967 17:77188531-77188553 CCTTCCTGAGTGAGGCTAAATGG - Intronic
1152088301 17:78233327-78233349 CCTGCCTGAGGGACTCTGAGGGG + Intronic
1152114832 17:78378981-78379003 CCTTCTTGAGGGAGGGTGGGCGG + Intronic
1152117461 17:78397408-78397430 CCTTCCTAGGAGAGGCAGAAAGG - Intronic
1152129344 17:78466661-78466683 GCTTCCTGGAGGAGACTGAGGGG - Exonic
1152303425 17:79508281-79508303 CCTTCCGGAGGGAGGCTTAGTGG + Intronic
1152510065 17:80780762-80780784 CCCCCCGGGGGGAGGGTGAGGGG - Intronic
1152684724 17:81688388-81688410 CCTGCCTGTTGGAGGCTGACGGG + Intronic
1152901196 17:82941994-82942016 CCTGCCGGAAGGAGGCTGAGAGG - Intronic
1154333394 18:13447962-13447984 GCTTCCTGGGGGAGGCCAAGGGG + Intronic
1154358973 18:13643341-13643363 CCTTCCTGGCGGAGGGGAAGGGG - Exonic
1154932003 18:21008850-21008872 CTCTACTGGGGGAAGCTGAGTGG - Intronic
1156651581 18:39232995-39233017 CCCTCCTGGGAGAGGTTGAGTGG - Intergenic
1156948499 18:42864788-42864810 CCTGCCTTGGCGAGGCTTAGTGG - Intronic
1157113962 18:44845814-44845836 CCTGCCTGGGGGATGGTGGGAGG + Intronic
1157523850 18:48363915-48363937 CCTTCATCTGGGAGGCTGTGGGG - Intronic
1157619950 18:49011260-49011282 CAGCCCTGGGGGAGGCTAAGAGG - Intergenic
1158602602 18:58867568-58867590 CCTTCCTGGGAGAGCCAGGGGGG + Intronic
1160563959 18:79775518-79775540 CCGTCCTGGGTGGGGCAGAGCGG + Intergenic
1160865181 19:1253115-1253137 CCTCCCTGGGGAAGGCTAATGGG - Intronic
1160939141 19:1611993-1612015 CCTTCCTTGAGAAGGCTGGGGGG + Intronic
1161266399 19:3366649-3366671 CGTACCTGGGTGAGGCAGAGCGG - Exonic
1161477436 19:4494321-4494343 CCGACCGCGGGGAGGCTGAGCGG + Exonic
1161520768 19:4722606-4722628 CCTGAGTGGGGGAGGCTGAACGG - Intronic
1162311415 19:9909672-9909694 CCAACGTCGGGGAGGCTGAGGGG - Intronic
1162396214 19:10419280-10419302 CCATCCTTGGGGGGGTTGAGGGG + Intronic
1163015515 19:14451777-14451799 CACTTCTGGGGCAGGCTGAGCGG - Intronic
1163585693 19:18162268-18162290 CCTCCCTGCAGGATGCTGAGTGG + Exonic
1163758774 19:19121692-19121714 CCTGCCTGGGGGACCCTGGGAGG + Intronic
1165421754 19:35725519-35725541 TCTGCCTGGAGGAGGCCGAGCGG + Exonic
1165685562 19:37817171-37817193 CCTGGCTGGGGTAGGCTGAAAGG - Intronic
1165712775 19:38024002-38024024 TCTTCCTTGGGGAGGGGGAGGGG + Intronic
1165862916 19:38918526-38918548 CCTTCCTGGGGGAGGAGGCCAGG + Exonic
1166423243 19:42654279-42654301 CCTTCCTGGGAGAGGACGGGAGG + Intronic
1166685679 19:44794709-44794731 CCGCACTGTGGGAGGCTGAGGGG - Intronic
1167012289 19:46816477-46816499 CCGCCGTTGGGGAGGCTGAGAGG + Intergenic
1167377421 19:49119455-49119477 CCTCGCGGGGGGAGGCTGATCGG + Exonic
1167486011 19:49763333-49763355 CCTTTGTGAGGCAGGCTGAGGGG - Intergenic
1167522063 19:49960998-49961020 CCGTGCTGGGGGCGGGTGAGTGG - Exonic
1167523319 19:49969727-49969749 CCGTGCTGGGGGCGGGTGAGTGG + Intergenic
1167657414 19:50774171-50774193 AACTCCTGTGGGAGGCTGAGCGG + Intergenic
1167706905 19:51086556-51086578 CTCCCCTGGAGGAGGCTGAGGGG + Intergenic
1167735383 19:51291494-51291516 CCTTCCTGGGGGAGCCAGCTGGG - Intergenic
1168651851 19:58097141-58097163 GACTCCTGGGCGAGGCTGAGTGG - Intronic
926099274 2:10103654-10103676 CTTCCCTGGTGGAGCCTGAGAGG - Intergenic
926104101 2:10139548-10139570 CATTGCTGGGGGCGGATGAGGGG + Intergenic
926136834 2:10342498-10342520 CCAGCCTGGGGGAGGGTGGGAGG + Intronic
926315162 2:11704387-11704409 CCCACCCGGGGGAGGCAGAGCGG + Intronic
926987208 2:18638273-18638295 CCTTCCTGGGTGTGTCTGTGAGG + Intergenic
927200598 2:20575772-20575794 CCTTGCTGGGGTAGCCTGAAGGG - Intronic
927811235 2:26181409-26181431 CCTGCCTGGCGGAATCTGAGAGG - Intronic
928498218 2:31857823-31857845 CCTGCCTTTGGGAGGCGGAGCGG + Intergenic
928767829 2:34669789-34669811 CCTGCCTGGGGGATGATCAGAGG - Intergenic
929039869 2:37734024-37734046 CCTTCTGTGGGGAGCCTGAGGGG - Intronic
930031646 2:47061574-47061596 CCTCCCTGTGGGAAGCTCAGAGG + Intronic
930104891 2:47632025-47632047 CCACCCTGGGGCATGCTGAGAGG - Intergenic
930374288 2:50545387-50545409 CCTTACTGTGGAATGCTGAGTGG - Intronic
931862830 2:66374393-66374415 CCTTCCTGGGGAAGAATTAGAGG + Intergenic
932462887 2:71894631-71894653 CCATCCTGGGGAGGGGTGAGAGG - Intergenic
932566572 2:72914933-72914955 ACTTCCCGGGGGAGGGGGAGGGG - Intergenic
932714686 2:74092796-74092818 GCATCGTGGGGGAGGCTGGGAGG - Intronic
933759617 2:85664761-85664783 CCTATCTGGGAAAGGCTGAGGGG + Intronic
934052329 2:88221165-88221187 CTTTCCTGGGGGTGGCTAGGAGG + Intergenic
934704094 2:96464253-96464275 CCTTCCTGAGCTAGGGTGAGAGG - Intergenic
936057165 2:109269895-109269917 CTTTCCTGGGAGGGGATGAGGGG - Intronic
936534521 2:113301815-113301837 CATTCCTGGGATAGGCAGAGAGG + Intergenic
937906476 2:127055179-127055201 CCTTCATGGTGGAGGCCGGGTGG - Intronic
938260548 2:129892433-129892455 GCTTCCAGGGAGAGGCAGAGTGG + Intergenic
938595543 2:132784006-132784028 CCTGCCTGGAGGGGGCGGAGGGG + Exonic
939612887 2:144332055-144332077 TCTTCCTCGCGCAGGCTGAGAGG - Intronic
941647415 2:168056330-168056352 GCTTCCGGGGGGAGGGGGAGGGG + Intronic
942281638 2:174370296-174370318 CCTCACTTTGGGAGGCTGAGAGG - Intronic
942963993 2:181867155-181867177 CCTTGATGGGGGAGGGTGAGAGG + Intergenic
945833045 2:214809378-214809400 GCTTCTTGGGGGTGGCTGCGAGG - Intronic
946184790 2:217974393-217974415 CTTTCTGGGGAGAGGCTGAGGGG - Intronic
946622529 2:221573960-221573982 CCTTCCGGGGGTTGCCTGAGTGG + Intronic
947806340 2:232971043-232971065 ACTTTCTGGGGGAGGCTAACTGG - Intronic
947825978 2:233106328-233106350 CATTCCTGGGCCAGGCTGAAGGG + Intronic
948202196 2:236137242-236137264 CTTGCCCGGAGGAGGCTGAGGGG + Intergenic
948679931 2:239626956-239626978 ACTTCCAGAGGGAGGCTGACAGG + Intergenic
948770171 2:240247793-240247815 TCTGCCTGGGGGAGGTTGAATGG + Intergenic
1168757294 20:326187-326209 CGTTCGTGCGGGAGGCGGAGCGG + Exonic
1168818563 20:757746-757768 CCTTCCTGGGAGGGACTGACTGG + Intergenic
1169155205 20:3323737-3323759 CCTGCTCTGGGGAGGCTGAGTGG + Intronic
1169381699 20:5113048-5113070 CCCGCCTGGGGCCGGCTGAGTGG - Exonic
1169775550 20:9248941-9248963 CCTTTCTGGGGGCTCCTGAGGGG + Intronic
1169847022 20:10005042-10005064 CCTGCCATGGGGAGGGTGAGGGG + Intronic
1170305094 20:14929622-14929644 CCATCCTGGAGGAGGGAGAGTGG + Intronic
1170736085 20:19015282-19015304 CCTTCCTGGAGGAGCATGCGAGG + Intergenic
1172034827 20:32003244-32003266 CCCTCCTGGGGGAAGCTCGGAGG - Exonic
1172117581 20:32581945-32581967 TCTTCCTGGGAGGGGCTGAATGG - Intronic
1173223187 20:41145994-41146016 CCATCCTGGGGGAGGCAGGGAGG + Intronic
1174426587 20:50435904-50435926 CCCACCTAGGGCAGGCTGAGAGG + Intergenic
1174449587 20:50611010-50611032 CCTTCCTCAGGGATGGTGAGGGG - Intronic
1174760640 20:53203612-53203634 CCCTCCTAGGGGAGGCAGTGTGG - Intronic
1175242636 20:57561035-57561057 CCTCCCTGGGTGCAGCTGAGGGG + Intergenic
1175542605 20:59757168-59757190 CCTCCCTTGGGGAGGCTCACAGG - Intronic
1175817547 20:61891380-61891402 GGTTCCAGGGGGAGGCTGTGAGG - Intronic
1175822408 20:61917473-61917495 CCTTCCTGTGGGAGGCTCGCAGG + Intronic
1175847879 20:62068068-62068090 CCTTCCGGGGGGGGGGGGAGGGG + Intergenic
1175923166 20:62459335-62459357 GGTCCCTGAGGGAGGCTGAGTGG - Intergenic
1175988184 20:62774676-62774698 CCTTCCAGGCAGGGGCTGAGGGG + Intergenic
1176058405 20:63160958-63160980 CCCATCTGGAGGAGGCTGAGTGG + Intergenic
1176234299 20:64047222-64047244 CTTTCCTGAGGGAGGCTGGCAGG - Intronic
1176304354 21:5115458-5115480 AGTGCCTGCGGGAGGCTGAGAGG + Intergenic
1180670498 22:17548967-17548989 CCTTGGTGGGGGAGGCTGACTGG - Exonic
1180932780 22:19604774-19604796 CCTTCCTGGGGGAATGTGACTGG + Intergenic
1181359358 22:22323009-22323031 CCCTCCTGGGGGAGGAAGAAGGG - Intergenic
1181442069 22:22941835-22941857 CCTTGCTGTGGGAGGCTGGGGGG + Intergenic
1181477188 22:23176000-23176022 CCTGCCTGCGTGAGGCTGGGTGG - Intergenic
1181985786 22:26799128-26799150 CCTGCCTGGGGGGGGCTCTGGGG - Intergenic
1182256147 22:29040043-29040065 TCTTCCTGGAGGAGGGTGACAGG + Intronic
1183342155 22:37287391-37287413 ACCTGCTGGAGGAGGCTGAGTGG - Intronic
1183365903 22:37406709-37406731 ACTTCCTGGGGGAGGCTGAGGGG + Intronic
1183465458 22:37978087-37978109 CCTTCATCGAGGAGGCTGAGCGG - Exonic
1183690036 22:39383217-39383239 CCTCCCTATGGGAGGCAGAGCGG + Exonic
1183700744 22:39449609-39449631 GCTGCCTGGGGAAGGCAGAGGGG + Intergenic
1183884679 22:40869029-40869051 CCTTTCTGGGACAGGCTGAAGGG - Exonic
1184656448 22:45944317-45944339 CCTTCCTGGGGGTGGCATGGAGG - Intronic
1184756599 22:46519596-46519618 CCTTCCTGGGCGGGGTTGGGAGG + Intronic
1184784749 22:46666210-46666232 CCCTCCCTGTGGAGGCTGAGGGG + Intronic
1185035579 22:48475045-48475067 CCGGCCTGTGGGAGGCAGAGGGG - Intergenic
1185035595 22:48475083-48475105 CCAGCCTGCGGGAGGCAGAGGGG - Intergenic
1185146540 22:49140084-49140106 ACTTCCTGGGGGAGGCAGCCGGG - Intergenic
1185253027 22:49815615-49815637 CCTTCCTGGTGCAGGCTGACAGG - Intronic
1185391794 22:50565683-50565705 CCTTCCCAGGGGAGGCTTACTGG + Intergenic
1203292154 22_KI270736v1_random:5595-5617 CCTTCTGTGGGGAGCCTGAGGGG - Intergenic
949105522 3:197222-197244 CCTCCCGGGTGCAGGCTGAGGGG - Intronic
949773720 3:7607881-7607903 CCTACTTGGGGGAGGGTGAGAGG - Intronic
949935496 3:9112618-9112640 CTCTCCTGGGGAAGGCGGAGGGG + Intronic
950425928 3:12924738-12924760 GCTTCCTGGGGTAGGACGAGAGG + Exonic
950563329 3:13748790-13748812 CTTTCCTGGGGGTGGCTGGCAGG + Intergenic
950661149 3:14467779-14467801 GCTTCCTGGAGGAGGCAGCGAGG - Intronic
950718433 3:14865834-14865856 CCTTCTTGGGAGAGGAGGAGTGG - Intronic
950836056 3:15920073-15920095 CCTTGATGGGGAAGACTGAGTGG - Intergenic
951528630 3:23678272-23678294 CCTTCCTGGGGGATGGGGCGTGG + Intergenic
952524501 3:34196228-34196250 CCTACATGGGGCAGGGTGAGGGG - Intergenic
953706839 3:45237563-45237585 CATTCCTGGTGGAAGGTGAGGGG - Intergenic
953710323 3:45264492-45264514 GCTTCCTGGGGCAGGGTGTGAGG + Intergenic
954066731 3:48112632-48112654 CCCTTCTGGGGGAGGCTTTGTGG - Intergenic
954717690 3:52534397-52534419 CCACGCTGGGGGAGGCCGAGGGG + Intronic
955960648 3:64337931-64337953 CCTGCATGAAGGAGGCTGAGAGG + Intronic
960535784 3:118813095-118813117 CCTGGCTGGGGGATGCTGATGGG + Intergenic
960590109 3:119357406-119357428 CATTCCTGTGTGGGGCTGAGAGG + Intronic
961394439 3:126577472-126577494 GCCTCCTGGGGGAGGCAGACTGG + Intronic
961451714 3:127005197-127005219 CCTCCCGGGCGGAGGGTGAGCGG - Exonic
962398009 3:135034523-135034545 TCTGCCTGGGGGAGGATTAGAGG + Intronic
962809960 3:138951360-138951382 CCTTCCTGGGGGAGAAAGAGGGG - Exonic
966341801 3:178933326-178933348 ACTTGATGGGGGAGGGTGAGAGG + Intergenic
966711136 3:182974001-182974023 CACTCCTTTGGGAGGCTGAGAGG + Intronic
967420024 3:189262381-189262403 CATTACTGGGGGTGCCTGAGAGG + Intronic
968642495 4:1721590-1721612 CCTTCCTGGCGGCGGCGGCGCGG + Exonic
968707449 4:2086757-2086779 CCTTCCTGGGGGAGCATGGCCGG + Intronic
968720161 4:2196717-2196739 CTTTCCTGGGGAAGGGGGAGAGG - Intronic
968808305 4:2788803-2788825 ACTCCCTGGGGGAGGCTGTGTGG - Intergenic
969323212 4:6425545-6425567 ACGTCATGGGGGAGGCTGAGGGG - Intronic
970131301 4:12874934-12874956 CCTTCCTGGGCCTGGCTGAGTGG + Intergenic
972780453 4:42282824-42282846 TGTCACTGGGGGAGGCTGAGAGG - Intergenic
973820779 4:54659578-54659600 CTTTCCTGTGGGGGGCAGAGAGG + Intronic
974836316 4:67255328-67255350 CCTTCCTGGTCTAGTCTGAGAGG + Intergenic
975914526 4:79308425-79308447 CATTTCAGGGGGAGGCAGAGGGG - Intronic
977809750 4:101346178-101346200 CCTTCCAGGGGGAGGGGGAGGGG + Intronic
979294779 4:119019056-119019078 ACTTGATGGGGGAGGCTGGGAGG + Intronic
979725115 4:123951889-123951911 CCTTCCTGGGGGAGGGGAAGAGG + Intergenic
981930107 4:150180724-150180746 CCTGCCTGGGGGAGAAAGAGGGG - Intronic
982079282 4:151771933-151771955 CCTGCCTGAGAGAGGCTGAAGGG - Intergenic
984099513 4:175468350-175468372 CATTACTTTGGGAGGCTGAGGGG - Intergenic
984766500 4:183404343-183404365 CCTTCCTGAGGCGTGCTGAGTGG - Intergenic
985645688 5:1083731-1083753 TCTTCCTGGGTGAGGCTCACAGG - Exonic
985928489 5:3036030-3036052 TCTTCCTGGGGTTGGATGAGGGG - Intergenic
988538162 5:32087289-32087311 CCCTCATGGGGGAGCCTGACTGG - Exonic
988684213 5:33512283-33512305 CTCTCCTGTGGGTGGCTGAGTGG + Intergenic
989427693 5:41315690-41315712 CATTGCTGGTGGAGGTTGAGAGG - Intronic
990320873 5:54628613-54628635 CCTTCCTGGGGGCAGCTGCCTGG - Intergenic
991693618 5:69249427-69249449 GCTTCTTGGGGGGGTCTGAGTGG + Intronic
992546254 5:77816873-77816895 CCTTCCTGGCAGTGGCAGAGGGG - Intronic
995627352 5:114093627-114093649 CATTCCTGGCGGAAGGTGAGGGG + Intergenic
996269162 5:121581308-121581330 CCTTCCTAGTGCAGGCTGACAGG - Intergenic
997224125 5:132195967-132195989 CCTTCCTGGGGCCAACTGAGTGG + Intronic
997615025 5:135240314-135240336 GCTTCCTGGAGGAGGCTGGGTGG + Intronic
997615702 5:135244824-135244846 CCTTGTTGGAGGAGGCTCAGTGG + Intronic
997635028 5:135398722-135398744 CCTTCCTGGGGCGGGCTCACGGG - Intronic
997710792 5:136002383-136002405 CCTTCCTGGGTGATCTTGAGCGG - Intergenic
998461445 5:142313200-142313222 CCTTCCTGGGGGTGGCCAAAAGG + Exonic
998504365 5:142660276-142660298 CCTTCCAGTCAGAGGCTGAGTGG - Intronic
998622846 5:143813148-143813170 CATTCCCTGGGGTGGCTGAGGGG - Intronic
999181841 5:149675371-149675393 CCTTCCTTGGAGAGGCTGATAGG - Intergenic
1000336566 5:160245785-160245807 CCCTCCTGGGGGAAGCTCTGGGG + Intergenic
1000367535 5:160505407-160505429 CCTTCCTGGGGAATACTGATGGG + Intergenic
1001116041 5:168940919-168940941 CAGTCCTGGGGGATCCTGAGTGG - Intronic
1001234491 5:170018227-170018249 CCCATCTGGGGGAGGCTGCGTGG + Intronic
1001766102 5:174248321-174248343 CCTTCCAGCGGGAGCCTGAGAGG + Intergenic
1001845502 5:174917803-174917825 GGATCCTGGGGGAGGCAGAGAGG - Intergenic
1002762853 6:215162-215184 CCCTCCTGGGTGATGCTGTGAGG + Intergenic
1002890413 6:1326944-1326966 CCCTCCTGGAGGAGGCTCAGGGG + Intergenic
1005081027 6:21956769-21956791 CCTGCCTGGGGATGGATGAGGGG - Intergenic
1006424661 6:33956525-33956547 GCTTCCTGGGGCTGGCTGTGAGG + Intergenic
1006984903 6:38169669-38169691 ACAGCCTTGGGGAGGCTGAGGGG + Exonic
1007738977 6:43999778-43999800 TCTTCCTGGGGAAGGATGGGAGG - Intergenic
1007790677 6:44306528-44306550 TCTCCCTGGGGGAGGTGGAGAGG + Exonic
1009905827 6:69868374-69868396 CCTTCCTGAGGAGGGCTGACAGG + Intronic
1011340455 6:86307723-86307745 GCTTCTTGGTGGAGGCTGGGGGG - Intergenic
1013925750 6:115469315-115469337 CCTTGCTGGGGGATGATCAGTGG + Intergenic
1017220067 6:151955872-151955894 CCTACGTGAGGGAGGGTGAGAGG - Intronic
1018421117 6:163641845-163641867 CCCACCTGCGGGAGGGTGAGAGG + Intergenic
1018448771 6:163885452-163885474 ACTTCCTGGGAAAGGCTGTGTGG - Intergenic
1018967241 6:168498592-168498614 CCTTCCTGCTGCAGGCTGAGTGG + Intronic
1019270404 7:143966-143988 CCTGCCTGGGGGTGGCCAAGGGG - Intergenic
1019316897 7:391058-391080 CCTTCCTTGGGGAGCGGGAGGGG + Intergenic
1019348992 7:544411-544433 CCTGCCTGGGGGAGGCCGCCCGG - Intergenic
1019564797 7:1673962-1673984 CCTTCAGAGGGGAGGCAGAGAGG + Intergenic
1019634326 7:2067405-2067427 GCTTCCTGGGGGAGGAAGAGTGG - Intronic
1019702492 7:2480693-2480715 CCGTCCTGAGGGAGGCAGAGAGG - Intergenic
1020023946 7:4885343-4885365 CCTTCCTGGGGTAGGCGAGGAGG - Intergenic
1020756653 7:12211459-12211481 CCTTCCGGAGCGAGGCTGAGCGG + Intronic
1021327794 7:19296231-19296253 CCTCACTGGGGGAAGCAGAGGGG - Intergenic
1021554259 7:21903768-21903790 TTTTCCTGGGCCAGGCTGAGAGG - Intronic
1023856784 7:44188984-44189006 GCCTACTGGGGAAGGCTGAGGGG - Intronic
1024166693 7:46740552-46740574 TCTTGCTGAGGGAGGCAGAGGGG - Intronic
1024612977 7:51083093-51083115 CCTTCCCCGGGAAAGCTGAGAGG + Intronic
1024663269 7:51520085-51520107 CCTTCTGAGAGGAGGCTGAGAGG - Intergenic
1025218369 7:57080756-57080778 TCTTTCTTTGGGAGGCTGAGGGG + Intergenic
1025629288 7:63254375-63254397 TCTTTCTTTGGGAGGCTGAGGGG + Intergenic
1025652977 7:63489705-63489727 TCTTTCTTTGGGAGGCTGAGGGG - Intergenic
1025898201 7:65723215-65723237 CCCTCCTGCAAGAGGCTGAGTGG - Intergenic
1026876025 7:73879555-73879577 CCTTCCTGGGCTCAGCTGAGAGG + Intergenic
1026882923 7:73919068-73919090 GCTTCCTGGAGGAGGCGGAGTGG + Intergenic
1027151009 7:75733640-75733662 GCTTCCTGGAGGAGGCTGGCAGG + Intronic
1028640414 7:93036301-93036323 TCTTCCTGGGGAAAGCTGATGGG + Intergenic
1033333384 7:140433335-140433357 TCTTCCCTGGGCAGGCTGAGGGG - Intergenic
1034201177 7:149283883-149283905 CCTTCCTGAGGGATTCTGACAGG - Exonic
1034420212 7:150986629-150986651 CCCTCCTGGGGGCACCTGAGAGG + Intergenic
1034627368 7:152503703-152503725 CCTGCCAGGGGGAGGCAGGGAGG + Intergenic
1035177645 7:157063410-157063432 CAACACTGGGGGAGGCTGAGTGG + Intergenic
1035373647 7:158394284-158394306 CCTTGGTGGGGGAGCCAGAGGGG - Intronic
1035548177 8:499738-499760 CCTTCCCGGGGGATGCTCAGAGG - Intronic
1036993441 8:13627088-13627110 CCTTCCTGGGTGGGACTCAGGGG - Intergenic
1038380070 8:27084545-27084567 CCTTTATGGGGGAGGCTTAGGGG - Intergenic
1038685911 8:29718495-29718517 GCTTTCTGGGGGAGCCAGAGAGG - Intergenic
1039339047 8:36626794-36626816 CCCTCCATGGTGAGGCTGAGTGG + Intergenic
1039708914 8:40036051-40036073 CCTTCCAGGTGAAGCCTGAGAGG - Intergenic
1039867440 8:41517761-41517783 CCTTCCTGGTGCTGGCTCAGTGG + Intergenic
1039885672 8:41652879-41652901 CCTTCCTAGGGAATGCTGGGGGG + Intergenic
1041107844 8:54459097-54459119 CCTTCGTGGAGGAGGCAGAGCGG + Exonic
1041438400 8:57867126-57867148 CCTTGCTGGTGGAGGCCGAGTGG + Intergenic
1043941757 8:86204373-86204395 CATACCTGGGGAAGGCAGAGAGG + Intergenic
1046715371 8:117561208-117561230 TCTTCCTTGGGGAGGATGAGTGG - Intergenic
1047193057 8:122696022-122696044 CACTGCTCGGGGAGGCTGAGGGG + Intergenic
1047450239 8:124958900-124958922 CCACCCTTTGGGAGGCTGAGAGG - Intergenic
1048373470 8:133801163-133801185 CCTTCCAGGGGCAGGCAGAATGG - Intergenic
1049107886 8:140624987-140625009 CCTTCCTGGAGGAGGCTGCTGGG - Intronic
1049295658 8:141834597-141834619 CATTCCTGGAGGAGGCAAAGTGG + Intergenic
1049358697 8:142201614-142201636 CCTTCCAGGGGGAGGCTGGGGGG - Intergenic
1049452350 8:142669092-142669114 CCGTCCTGTGTGAGGCTAAGAGG + Intronic
1049584279 8:143425753-143425775 CCTTCCTGGAGGAGGCTGCCTGG - Intronic
1049708788 8:144054553-144054575 TCTTCCAGGAGGAGGGTGAGTGG - Exonic
1049802872 8:144526383-144526405 CCTTCCTGGGGGAGGCTGAGTGG - Exonic
1050328487 9:4521412-4521434 CTTTCCTGGAGGTGGCAGAGGGG - Intronic
1050627783 9:7523819-7523841 CCTTCCTGTAGGAGCCTTAGTGG + Intergenic
1053070877 9:35101265-35101287 GCTTCCAGGTGGAGGCAGAGCGG - Exonic
1056331928 9:85528473-85528495 CCTTGCTGGGGGCCGCTGACAGG - Intergenic
1056557632 9:87703077-87703099 CCTTCCTGGAGGAAGCTCAATGG + Exonic
1056803324 9:89709111-89709133 CCATGCTAGGAGAGGCTGAGTGG - Intergenic
1056831769 9:89923129-89923151 CCTTCCAGGAGGTGGGTGAGGGG + Intergenic
1057222603 9:93265333-93265355 CCTTGCTGGGGGTGGGTGAGAGG + Intronic
1057281351 9:93713939-93713961 CCTTCCTTGTGGTTGCTGAGGGG + Intergenic
1057442252 9:95091037-95091059 CGGGCCTGGGGGAGGCCGAGGGG + Intergenic
1057985727 9:99711776-99711798 CCTGCATGGGGGTGGCTAAGAGG - Intergenic
1059259764 9:112964253-112964275 TCTTCCTGGGTCATGCTGAGGGG + Intergenic
1060029825 9:120204719-120204741 ACTTCCTGGGAGAGGCTTAAGGG + Intergenic
1060047520 9:120352299-120352321 TGTTCCTGGGAGAGGCTGAGAGG - Intergenic
1060111543 9:120910107-120910129 CCCTTCTGGGAGAGGCTGACTGG + Intronic
1060406580 9:123375892-123375914 CCTTCCTGGGGCGGGGTGGGGGG + Intronic
1060530641 9:124345395-124345417 TGTTCCTGGGGAAGGCCGAGAGG + Intronic
1060934779 9:127508587-127508609 CCTTCCTGGGTGCCGCTGAGGGG + Intronic
1061003872 9:127917308-127917330 CCTGCCTGGGCGAGGCTGTCGGG + Intergenic
1062495105 9:136827928-136827950 CCTTGATGGCGGAGGCTCAGGGG + Intronic
1062526589 9:136980347-136980369 CCTGACTGGGGGAGGCAGAGGGG + Intronic
1062530209 9:136996381-136996403 CCTTCCTGTGGGTGGCTAGGGGG - Intronic
1062556579 9:137115620-137115642 CCATCCTGTGTGGGGCTGAGCGG + Intergenic
1187243228 X:17531821-17531843 CCTCCCTGGGGAAGCTTGAGGGG - Intronic
1192214785 X:69150632-69150654 CCTTCATGGTGGAGGGGGAGGGG - Intergenic
1195325399 X:103754314-103754336 CCTTCCTAAGGCAGGCTTAGTGG - Intergenic
1195728309 X:107939747-107939769 CCTTGCTGGGGTGGGCTGGGTGG - Intergenic
1196235442 X:113274403-113274425 GTTTCCAGGAGGAGGCTGAGAGG - Intergenic
1196899522 X:120368989-120369011 CACTCCTGGGTGAGGCTAAGGGG + Intronic
1201299684 Y:12494952-12494974 CCGTCCTGGGAGAGAATGAGAGG - Intergenic