ID: 1049803241

View in Genome Browser
Species Human (GRCh38)
Location 8:144527738-144527760
Sequence GCTGCGGTTGGGTCTCAGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049803234_1049803241 -10 Left 1049803234 8:144527725-144527747 CCTCGTAGCGCCCGCTGCGGTTG 0: 1
1: 0
2: 0
3: 3
4: 22
Right 1049803241 8:144527738-144527760 GCTGCGGTTGGGTCTCAGGCGGG 0: 1
1: 0
2: 0
3: 24
4: 217
1049803231_1049803241 18 Left 1049803231 8:144527697-144527719 CCGCAGGGCGAGAGGAAGGGGAA 0: 1
1: 0
2: 2
3: 22
4: 430
Right 1049803241 8:144527738-144527760 GCTGCGGTTGGGTCTCAGGCGGG 0: 1
1: 0
2: 0
3: 24
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049803241 Original CRISPR GCTGCGGTTGGGTCTCAGGC GGG Exonic
900359832 1:2283158-2283180 GCGGAGGCTGGGTCCCAGGCTGG + Intronic
901807916 1:11749573-11749595 GCTGGGGCTGGGTCCAAGGCAGG - Intronic
901808954 1:11755074-11755096 GCTGGGGCTGGGTCCAAGGCAGG - Intergenic
903501068 1:23800462-23800484 AGGGCGGCTGGGTCTCAGGCTGG + Intronic
904330472 1:29755121-29755143 GCTGCTGTTGGCCCTCAAGCAGG + Intergenic
905009417 1:34737074-34737096 GCTGAGGTTATGTTTCAGGCAGG - Intronic
905542701 1:38772822-38772844 GCTGGGGTTAGGGCTTAGGCTGG - Intergenic
906197281 1:43936813-43936835 TCTGCGGGAGGGTCCCAGGCAGG - Exonic
910760953 1:90730527-90730549 GCTGCGGTTGCGGCTGCGGCGGG - Intergenic
910864713 1:91777571-91777593 GCTGGGGTTGGGGCTGGGGCTGG - Intronic
912529473 1:110309977-110309999 GCTGCTCTCGGCTCTCAGGCAGG - Intergenic
912625889 1:111204303-111204325 GCCGCGCTTCAGTCTCAGGCTGG + Intronic
916177353 1:162053690-162053712 GCTGAGATGGGTTCTCAGGCTGG - Intergenic
916624851 1:166544405-166544427 GCTGGGGTTGGGAATGAGGCAGG - Intergenic
917135478 1:171784561-171784583 GCTGGGGCTGGGGCTGAGGCTGG + Intronic
918240063 1:182613100-182613122 CCTGAGGTTGTGTCACAGGCTGG - Intergenic
919565088 1:199174495-199174517 GCTGGGGCTGGATCTGAGGCTGG - Intergenic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
921433468 1:215089530-215089552 GCTGTGGTTGTGTCTCAGGGTGG + Intronic
921987515 1:221328106-221328128 GCTGCAGTTGGCTGTCAGCCAGG + Intergenic
924741078 1:246794450-246794472 GGTGGGGTGGAGTCTCAGGCAGG + Intergenic
1063379574 10:5575924-5575946 GCTGAGGGTGGGCCTCAGGAGGG + Intergenic
1063391032 10:5649991-5650013 GCTGGGGCTGGGTGTGAGGCTGG - Intronic
1064140456 10:12785731-12785753 GGTTCGGCTGGTTCTCAGGCAGG + Intronic
1065321999 10:24519006-24519028 GCTGCGGGAGGGGTTCAGGCAGG - Intronic
1065549988 10:26860619-26860641 GCTGCGGTAGGGGCTCGGGTTGG + Intronic
1066354619 10:34670319-34670341 GCCGCCGCTGGCTCTCAGGCAGG + Intronic
1066452397 10:35542593-35542615 AGTGGGGTTGGGTCTCAGCCTGG + Intronic
1067522228 10:47016617-47016639 ACTGCGGCTGGGACTCAGGCAGG + Intergenic
1069914222 10:71777532-71777554 GCAGGGGGTGGGTCACAGGCTGG - Intronic
1070626636 10:78055529-78055551 GCTGCGGTGGAAACTCAGGCAGG + Exonic
1075656483 10:124165136-124165158 GCTGCATTTGGGTGTGAGGCAGG - Intergenic
1075671380 10:124265988-124266010 GCTGGGGCTGGGAGTCAGGCAGG - Intergenic
1076111430 10:127862572-127862594 GCAGAGATTGGGTCTCAGGTAGG + Intergenic
1076875978 10:133215717-133215739 GCTCGAGGTGGGTCTCAGGCTGG - Intronic
1077560493 11:3257424-3257446 GATGCAGGTGGGACTCAGGCAGG - Intergenic
1077566389 11:3303241-3303263 GATGCAGGTGGGACTCAGGCAGG - Intergenic
1082784300 11:57308562-57308584 GCTGCCATTGTGCCTCAGGCCGG + Exonic
1083452061 11:62752823-62752845 GCTGACGTTGGGGCTGAGGCTGG + Exonic
1085209806 11:74765770-74765792 GCTGCGGTTGTTGCCCAGGCTGG - Intronic
1085407257 11:76270510-76270532 GCTGCTGGTGCCTCTCAGGCTGG + Intergenic
1088899328 11:114103297-114103319 ACTGTGCTTTGGTCTCAGGCTGG - Intronic
1089353880 11:117837361-117837383 CCTGCAATTGGGTCTCTGGCAGG - Exonic
1090195872 11:124816445-124816467 GCTGCTGTGGAGTCTGAGGCAGG + Intergenic
1094818135 12:34205900-34205922 GCTGTGGTGGGGGCGCAGGCAGG - Intergenic
1098070911 12:66673766-66673788 GCTGCAGCTGGGTCCCAGGCAGG - Intronic
1098893196 12:76030715-76030737 GCTTGGGTTGGGGCTGAGGCTGG + Exonic
1102391404 12:112551809-112551831 GCTGAGGATGGGTCATAGGCAGG + Intergenic
1102443147 12:112978797-112978819 GCTGAGGTTGGGTCTCTGGGAGG + Intronic
1103940149 12:124496961-124496983 GGTGGGCGTGGGTCTCAGGCAGG - Intronic
1106006361 13:25773576-25773598 GCTGCTGGTGGGTCCCAAGCTGG - Intronic
1106125264 13:26895849-26895871 GCCGCGGTGGGACCTCAGGCTGG - Intergenic
1106340091 13:28819748-28819770 GCTGGGGCTGGGGCTGAGGCGGG + Intergenic
1108031828 13:46239666-46239688 GCTGCTGTTGTGTCTCTGCCAGG - Intronic
1108467414 13:50730661-50730683 TCTGTGGTTGTGTTTCAGGCAGG + Intronic
1111117824 13:83803961-83803983 GCTGCGATTGGGGCTCACTCAGG - Intergenic
1115786967 14:36837282-36837304 ACTGCACTTGGGTCTCAGTCTGG - Intronic
1116870164 14:50062495-50062517 GCCTGGGTTGGGGCTCAGGCCGG - Intergenic
1120823015 14:88930417-88930439 GCTGCGGCTGGGGGTCAGGCTGG - Intergenic
1121713095 14:96053608-96053630 GCTGCTGTTGGGGCTCAGCCTGG - Intronic
1122558674 14:102595388-102595410 GCTACGGGGGGGTCTGAGGCTGG + Intronic
1122651892 14:103230870-103230892 GCTGCGGTAGGCTCCCTGGCAGG + Intergenic
1122913726 14:104846206-104846228 GCTGCTGGTGGGTGACAGGCAGG + Intergenic
1122915372 14:104855908-104855930 GCTGCACTTGGGTCTCAGCTGGG + Intergenic
1122938558 14:104970997-104971019 GCTGCCCTGGGGGCTCAGGCAGG - Intronic
1123466194 15:20517792-20517814 GCTGCGGTTGGCTGGCAGGCAGG + Intergenic
1123651921 15:22483247-22483269 GCTGCGGTTGGCTGGCAGGCAGG - Intergenic
1123742341 15:23292107-23292129 GCTGCGGTTGGCTGGCAGGCAGG - Intergenic
1123760985 15:23432379-23432401 GCTGCGGTTGGCTGGCAGGCAGG + Intergenic
1124276919 15:28333768-28333790 GCTGCGGTTGGCTGGCAGGCAGG + Intergenic
1124305781 15:28577838-28577860 GCTGCGGTTGGCTGGCAGGCAGG - Intergenic
1129460980 15:75699955-75699977 GCTGGGGTAGGGTTTCTGGCAGG + Intronic
1129723840 15:77891763-77891785 GCTGGGGTAGGGTTTCTGGCAGG - Intergenic
1130059472 15:80559317-80559339 GCTGGGGCTGGGTCTGGGGCTGG - Intronic
1130090490 15:80816708-80816730 GGTGGGGATGGGTCTCAGGACGG + Intronic
1131264864 15:90910003-90910025 GCTGCAGTTGGGGGTGAGGCAGG - Intronic
1132317722 15:100901965-100901987 GCTGGGTTTGGGGCACAGGCTGG - Intronic
1132891998 16:2209147-2209169 GCTGCTGAGGGGTCTGAGGCTGG + Exonic
1136922884 16:34346241-34346263 GCAGCTGGTGGGTCCCAGGCTGG + Intergenic
1136981689 16:35065565-35065587 GCAGCTGGTGGGTCCCAGGCTGG - Intergenic
1137056616 16:35749242-35749264 GCCGCGGTGGGGGCACAGGCGGG - Intergenic
1138507723 16:57486465-57486487 GCTCCGGCTGGGGCTCCGGCTGG + Exonic
1138521123 16:57571380-57571402 GCTGGGGCTTGGTCTCCGGCAGG + Intronic
1139206961 16:65038184-65038206 GCTGAGATTGGGGCTCTGGCAGG + Intronic
1139400033 16:66674127-66674149 GATGCAGTTGGGTCACAGTCTGG + Intronic
1139487980 16:67269967-67269989 GCTGTGGTGGGTACTCAGGCAGG + Intronic
1139691166 16:68642951-68642973 GCTGGGGCTGGGACTGAGGCTGG - Intronic
1141014642 16:80437648-80437670 GCTGGGGATGGGGCTCAGCCAGG - Intergenic
1141620905 16:85236019-85236041 GCTGCGGCTGGGGCTGGGGCTGG + Intergenic
1142355202 16:89598578-89598600 GGTGTGGGGGGGTCTCAGGCTGG + Intergenic
1142355230 16:89598681-89598703 GGTGTGGGGGGGTCTCAGGCTGG + Intergenic
1142355258 16:89598784-89598806 GGTGTGGGGGGGTCTCAGGCTGG + Intergenic
1142355286 16:89598887-89598909 GGTGTGGGGGGGTCTCAGGCTGG + Intergenic
1142355327 16:89599035-89599057 GGTGTGGGGGGGTCTCAGGCTGG + Intergenic
1142355370 16:89599183-89599205 GGTGTGGGGGGGTCTCAGGCTGG + Intergenic
1142865888 17:2791258-2791280 CCTGGGGTTGGGACTCTGGCTGG + Intronic
1143103207 17:4515142-4515164 TCTGCGGTTCTGTCCCAGGCTGG + Intronic
1143379487 17:6487139-6487161 GCTGAGGTTGGCTCTAGGGCTGG + Intronic
1143448551 17:7022576-7022598 GCTCCCGTAGGGTCTCAGACGGG - Intergenic
1144137745 17:12314560-12314582 GCTGGTAGTGGGTCTCAGGCAGG + Intergenic
1144713338 17:17417556-17417578 GCTGTGGTTGGGGCTCATTCAGG + Intergenic
1144960446 17:19041505-19041527 GCTGCTGTGTGGCCTCAGGCAGG - Intronic
1144974714 17:19133019-19133041 GCTGCTGTGTGGCCTCAGGCAGG + Intronic
1145788236 17:27608029-27608051 GCTGGGGGTGGGTTTCTGGCCGG + Intronic
1146635905 17:34504321-34504343 GCTGCGGTTTGGACTAAGGATGG + Intergenic
1146891815 17:36511288-36511310 GCTGGGGTTGGGTGGAAGGCTGG - Intronic
1146913942 17:36666087-36666109 GCCGCTGTTGGGGCTGAGGCTGG + Intergenic
1147746611 17:42698812-42698834 GCTGGGGCTGGGGCTGAGGCTGG - Exonic
1148419291 17:47531765-47531787 GCTGAGGCTGGGGCTCGGGCTGG + Intronic
1148542598 17:48492479-48492501 GCTGCGGTGGGGGCTGGGGCTGG - Intergenic
1148699545 17:49579382-49579404 GAAGGGGTTGGGCCTCAGGCAGG + Exonic
1150440736 17:65189490-65189512 GCTGGGGCTGGGGCTGAGGCTGG + Intronic
1150883674 17:69059929-69059951 GTTGCAGTTTGGTTTCAGGCAGG - Intronic
1151974470 17:77476517-77476539 GTTGCAGGTGGGTCTAAGGCAGG - Intronic
1152647182 17:81474810-81474832 CCTGCTGTTGGGTGTCAGGTAGG + Intergenic
1152709500 17:81863927-81863949 GCCGTGGATGAGTCTCAGGCTGG + Intergenic
1152903193 17:82956951-82956973 TCTGCAGTCGGGTGTCAGGCGGG - Intronic
1158190988 18:54828512-54828534 GCTCCGGATGGGTCCAAGGCCGG - Exonic
1158478934 18:57803557-57803579 GCAGCAACTGGGTCTCAGGCTGG - Intergenic
1159904650 18:74078436-74078458 GCTGCGGCTGGTGCTGAGGCGGG - Intronic
1161441226 19:4292701-4292723 GCTGGGGCAGGGTCTCGGGCTGG + Exonic
1161653343 19:5498461-5498483 GCTGGGATTGGGGCTCAGCCTGG - Intergenic
1161653359 19:5498514-5498536 GCTGGGATTGGGGCTCAGCCTGG - Intergenic
1161653375 19:5498567-5498589 GCTGGGATTGGGGCTCAGCCTGG - Intergenic
1161653391 19:5498620-5498642 GCTGGGATTGGGGCTCAGCCTGG - Intergenic
1161653407 19:5498673-5498695 GCTGGGATTGGGGCTCAGCCTGG - Intergenic
1161653423 19:5498726-5498748 GCTGGGATTGGGGCTCAGCCTGG - Intergenic
1161653439 19:5498779-5498801 GCTGGGATTGGGTCTCAGCCTGG - Intergenic
1161653454 19:5498832-5498854 GCTGGGATTGGGTCTCAGCCTGG - Intergenic
1161653469 19:5498885-5498907 GCTGGGATTGGGGCTCAGCCTGG - Intergenic
1161653484 19:5498938-5498960 GCTGGGATTGGGGCTCAGCCTGG - Intergenic
1162475953 19:10899444-10899466 GCTGTGGGTGGGTCCCAGGAAGG - Intronic
1163277380 19:16293853-16293875 GGTGCGCCAGGGTCTCAGGCTGG - Intergenic
1164257754 19:23544130-23544152 GATGCATGTGGGTCTCAGGCAGG + Intronic
1165187346 19:34033443-34033465 GCTTTGGTTGGGTTTCAGGAAGG + Intergenic
1166717385 19:44977258-44977280 GCTGCAGATGGGTGCCAGGCAGG + Intronic
1166732594 19:45067480-45067502 GCTGCGGCTGCGGCTCTGGCTGG - Exonic
1166942247 19:46374096-46374118 GCTGTGGGTGGGTGTAAGGCAGG - Intronic
1167146258 19:47682054-47682076 GCTGGGGCTGGGTCTTGGGCGGG - Exonic
925021603 2:574006-574028 GCTGCGGTGGGTTTTCAGGGAGG - Intergenic
927888065 2:26730613-26730635 GCTGGGGTGGGGCCTGAGGCTGG - Exonic
927913297 2:26916573-26916595 GCTGAGGTTCGGGCTGAGGCAGG - Intronic
927963482 2:27255151-27255173 GCTGGGGCTGGGGCTGAGGCTGG + Exonic
928100528 2:28434795-28434817 GCTGCCGATGGGGCCCAGGCAGG + Intergenic
934707857 2:96497332-96497354 GCTGAGGTGGGCTCCCAGGCCGG + Intergenic
948085081 2:235240744-235240766 CCTGGGGGTGGGGCTCAGGCAGG - Intergenic
948836048 2:240626465-240626487 GCTGTGTTGGGGTCTCAGGTGGG + Intronic
1170360878 20:15544887-15544909 GCAGCGGTGGGGTCACAGTCTGG + Intronic
1171846527 20:30280858-30280880 GCTGGGGCTGGGTCTGCGGCTGG + Intergenic
1172639596 20:36432710-36432732 CCTGCAGGTGGGTCTCTGGCAGG + Exonic
1172768030 20:37361444-37361466 GGTGGGTTTGGGGCTCAGGCTGG + Intronic
1173725978 20:45298122-45298144 GCTGGGGTTGGGTCAGACGCTGG - Intronic
1174387741 20:50197324-50197346 GCTGAGCTTGGGGCTCAGGCAGG - Intergenic
1175285873 20:57836420-57836442 GCACCGGCTGGGTCCCAGGCTGG + Intergenic
1176244877 20:64092788-64092810 ACTGTGGTTGGGGCTCAGGAGGG - Exonic
1176387552 21:6146284-6146306 GCTGCGGCTGGGTGACTGGCGGG + Intergenic
1177894361 21:26843328-26843350 GCAGGGGTTGGGTCTCAGTCCGG - Intronic
1179008848 21:37537644-37537666 GCTGCGGTGGGTTCTGAGGCAGG + Intergenic
1179658438 21:42859998-42860020 GAGGCGCTTGGGTCTCTGGCAGG - Intronic
1179735920 21:43391964-43391986 GCTGCGGCTGGGTGACTGGCGGG - Intergenic
1179825099 21:43959929-43959951 GCAGCCGTGGGCTCTCAGGCAGG + Intronic
1181182134 22:21075769-21075791 GCTGCGGCTGCTTCTCAAGCAGG - Intergenic
1183718877 22:39550622-39550644 GGTGGGAGTGGGTCTCAGGCTGG - Intergenic
1184661922 22:45969374-45969396 GCTGCGCTTCTGTCCCAGGCAGG - Intronic
1184754060 22:46506513-46506535 GCTGGGGCTGGGGCTGAGGCTGG - Intronic
1185003295 22:48259850-48259872 GCTGCCTTTGGGCCTCTGGCAGG - Intergenic
1185329635 22:50246416-50246438 TCTGCGGTTTGGGCTCAGGAGGG - Intronic
950518993 3:13485181-13485203 GCTGCGGTTGGGGAGCAGGGAGG - Intronic
954106486 3:48412376-48412398 GCTGGGGTGGGGCCTCGGGCTGG - Intronic
961326676 3:126113186-126113208 GGTGCAGGAGGGTCTCAGGCAGG - Intronic
961519876 3:127460861-127460883 GATGGGGTGGGGTCACAGGCTGG - Intergenic
963025097 3:140911469-140911491 GCAGTGATTGGGTCACAGGCAGG + Intergenic
964010680 3:151887892-151887914 GCTGGGGCTGGGTCTGAGGCTGG + Intergenic
964011577 3:151898479-151898501 GCTGGGGCTGGGTCTGAGGCTGG - Intergenic
965818238 3:172658780-172658802 GCTGCAGTTCAGTCTCAGGAAGG + Intronic
966250849 3:177863633-177863655 CCTGGGGTAGGGTCTGAGGCTGG + Intergenic
968342379 3:197967387-197967409 GCTGCTTTTGCGGCTCAGGCGGG - Intronic
968517344 4:1020793-1020815 GCTGGGGTGGGGACCCAGGCAGG + Intronic
969534183 4:7745926-7745948 GCTCCGGGGGGGTCCCAGGCTGG + Intergenic
974194304 4:58551884-58551906 GCTGGGGTTGGCTCTCAGTTGGG - Intergenic
979523815 4:121697044-121697066 CCTGCGGTTGGGGCCCTGGCGGG - Exonic
979582788 4:122379622-122379644 GCTGCTGCTGCGCCTCAGGCCGG - Intronic
980088655 4:128418220-128418242 GTTGTGGTTGGGACTCAGTCTGG + Intergenic
984104014 4:175521730-175521752 TCTGCCGTTGGGTTTAAGGCTGG - Intergenic
985652963 5:1115560-1115582 CCTGCTGTCGGGTATCAGGCAGG + Intergenic
985963793 5:3324595-3324617 GGTGGGGCTGGGTCCCAGGCTGG + Intergenic
986597507 5:9439064-9439086 GCTGCTGGGGCGTCTCAGGCAGG - Intronic
997969491 5:138389110-138389132 GCTGCTGTTGCTTCACAGGCAGG - Intronic
998254644 5:140575344-140575366 GCTGAGGTTGGGGCTGAGGCCGG + Intronic
998396500 5:141821966-141821988 GCTGGGGTTTGGTTTCAGGAAGG - Intergenic
1000358266 5:160421959-160421981 GCTGCGGCTGGGGCTGAAGCTGG + Exonic
1001745460 5:174089246-174089268 GCTGGGGTTGAGGCTCAGGGTGG + Intronic
1003721726 6:8710712-8710734 GCTCCTCCTGGGTCTCAGGCTGG - Intergenic
1004895377 6:20142899-20142921 ACTGTGGTTTGGTCTCAGACTGG - Intronic
1006267898 6:32940768-32940790 GCTGCTGCTGGGGCTCAGCCTGG - Exonic
1006321746 6:33323258-33323280 CCGGCGGTTGGGCCCCAGGCAGG - Intronic
1006694599 6:35920717-35920739 GCGCCGGAGGGGTCTCAGGCCGG + Intronic
1010132945 6:72516811-72516833 GATGAGGTTGGGTCTTAGGGAGG + Intergenic
1013514591 6:110874587-110874609 GCTGCGGCTCGGGCTCTGGCCGG - Intronic
1018626144 6:165780871-165780893 GGTGCATTTGGGTCCCAGGCTGG + Intronic
1019464142 7:1177280-1177302 GCTGCGGTTGATGCTCAGGGAGG - Intergenic
1019659761 7:2217609-2217631 GCTGGAGCTGGGTCTCAGTCAGG - Intronic
1020603395 7:10304996-10305018 GCTGCTTTGGGGTCTGAGGCAGG + Intergenic
1022046547 7:26626681-26626703 GGTGCGGGTGGGTCTGATGCTGG + Intergenic
1022114666 7:27251610-27251632 GCTGCGGTGGCGACTCGGGCCGG + Intergenic
1024202210 7:47118971-47118993 GCTGGGGTTGGGGCTGGGGCTGG - Intergenic
1024609009 7:51046805-51046827 GCTGCCCCTGGGTTTCAGGCTGG - Intronic
1024675857 7:51637547-51637569 GCTGGGGTTGGAGCTTAGGCAGG + Intergenic
1026837048 7:73646495-73646517 GCTGGGGTTGGGACTCAGCCTGG - Intergenic
1027422364 7:78029574-78029596 TCTGCGGTTGGGACTCAGGGTGG - Intronic
1030138758 7:106284723-106284745 GCTGGGGTTGGGGCTGGGGCTGG - Intronic
1035126098 7:156608380-156608402 GGGGCGGATGGGTCCCAGGCAGG - Intergenic
1035316708 7:158001188-158001210 GCTGGGGTCGGGCCGCAGGCGGG + Intronic
1037834578 8:22208548-22208570 GCTGGGGTTGTGTCTCTGCCTGG - Intronic
1037881534 8:22575653-22575675 TCTGCCCTTGGGTGTCAGGCAGG + Exonic
1038013920 8:23497400-23497422 GCTGAGCCTGGGTCCCAGGCAGG + Intergenic
1039958043 8:42222114-42222136 GCTCCAGGTGGGTCTCAGCCAGG - Intergenic
1040285373 8:46098005-46098027 GCAGTGGCAGGGTCTCAGGCCGG + Intergenic
1040981559 8:53250957-53250979 GCTGCTGTTGGGGGGCAGGCAGG + Exonic
1043468661 8:80539643-80539665 ACTGCACTTGGCTCTCAGGCTGG + Intergenic
1046494604 8:114997257-114997279 GCTGCTTTTGAGGCTCAGGCAGG + Intergenic
1047311029 8:123692170-123692192 GCTGAGGTAGGAGCTCAGGCCGG + Intronic
1048533701 8:135273537-135273559 GCTGCGGTTGGGGCACAGGTAGG - Intergenic
1049655018 8:143793492-143793514 GCTGGGGCTGGGTCTCATGGGGG + Intronic
1049803241 8:144527738-144527760 GCTGCGGTTGGGTCTCAGGCGGG + Exonic
1060143666 9:121232752-121232774 GCAACAGTTAGGTCTCAGGCAGG + Intronic
1061069506 9:128300432-128300454 GCTGCAGTGGGGTCTGAGGAGGG + Intergenic
1185862060 X:3588963-3588985 GATGCAGTTGGGCCCCAGGCTGG - Intergenic
1186298292 X:8171363-8171385 GCTGGGTTTCGGTATCAGGCTGG + Intergenic
1186502398 X:10062087-10062109 GCTGTGGTTGGGTCCCATTCAGG + Intronic
1187382960 X:18821987-18822009 GTTACAGTTGGGTCTCCGGCTGG + Intronic
1187719661 X:22137803-22137825 GCTGCAGTTGGAAGTCAGGCAGG - Intronic
1189872352 X:45397277-45397299 CCTGGGGTAGGGTCTAAGGCTGG + Intergenic
1192795514 X:74421778-74421800 GCTCCGGCTGGGGCTCGGGCGGG - Exonic
1195094702 X:101492466-101492488 GCTGGGGTTGTGGATCAGGCCGG + Exonic
1195095085 X:101494020-101494042 GCTGGGGCTGGGGCTGAGGCTGG + Exonic
1195095092 X:101494038-101494060 GCTGGGGCTGGGGCTGAGGCTGG + Exonic
1195095102 X:101494062-101494084 GCTGGGGCTGGGGCTGAGGCTGG + Exonic
1195095106 X:101494074-101494096 GCTGAGGCTGGGGCTGAGGCTGG + Exonic
1198107991 X:133479145-133479167 GCTGTGATTAGGTGTCAGGCAGG + Intergenic
1199721484 X:150545884-150545906 GCTGGGGTTGGAGCTCAGGCAGG - Intergenic
1200068775 X:153517802-153517824 GCTGCGGGCGGGCGTCAGGCGGG - Intronic