ID: 1049803534

View in Genome Browser
Species Human (GRCh38)
Location 8:144528888-144528910
Sequence GTCCGGAGCGTCCCGCAAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 23}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049803527_1049803534 -1 Left 1049803527 8:144528866-144528888 CCGCGACCGCGCCAAGGCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1049803534 8:144528888-144528910 GTCCGGAGCGTCCCGCAAGGCGG 0: 1
1: 0
2: 0
3: 1
4: 23
1049803525_1049803534 0 Left 1049803525 8:144528865-144528887 CCCGCGACCGCGCCAAGGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1049803534 8:144528888-144528910 GTCCGGAGCGTCCCGCAAGGCGG 0: 1
1: 0
2: 0
3: 1
4: 23
1049803530_1049803534 -7 Left 1049803530 8:144528872-144528894 CCGCGCCAAGGCCAGGGTCCGGA 0: 1
1: 0
2: 0
3: 18
4: 138
Right 1049803534 8:144528888-144528910 GTCCGGAGCGTCCCGCAAGGCGG 0: 1
1: 0
2: 0
3: 1
4: 23
1049803520_1049803534 19 Left 1049803520 8:144528846-144528868 CCGCTGCAGGCCCGGGCTCCCCG 0: 1
1: 0
2: 3
3: 39
4: 454
Right 1049803534 8:144528888-144528910 GTCCGGAGCGTCCCGCAAGGCGG 0: 1
1: 0
2: 0
3: 1
4: 23
1049803524_1049803534 1 Left 1049803524 8:144528864-144528886 CCCCGCGACCGCGCCAAGGCCAG 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1049803534 8:144528888-144528910 GTCCGGAGCGTCCCGCAAGGCGG 0: 1
1: 0
2: 0
3: 1
4: 23
1049803515_1049803534 26 Left 1049803515 8:144528839-144528861 CCCATCCCCGCTGCAGGCCCGGG 0: 1
1: 0
2: 2
3: 28
4: 293
Right 1049803534 8:144528888-144528910 GTCCGGAGCGTCCCGCAAGGCGG 0: 1
1: 0
2: 0
3: 1
4: 23
1049803512_1049803534 28 Left 1049803512 8:144528837-144528859 CCCCCATCCCCGCTGCAGGCCCG 0: 1
1: 0
2: 0
3: 35
4: 417
Right 1049803534 8:144528888-144528910 GTCCGGAGCGTCCCGCAAGGCGG 0: 1
1: 0
2: 0
3: 1
4: 23
1049803517_1049803534 25 Left 1049803517 8:144528840-144528862 CCATCCCCGCTGCAGGCCCGGGC 0: 1
1: 0
2: 6
3: 45
4: 467
Right 1049803534 8:144528888-144528910 GTCCGGAGCGTCCCGCAAGGCGG 0: 1
1: 0
2: 0
3: 1
4: 23
1049803513_1049803534 27 Left 1049803513 8:144528838-144528860 CCCCATCCCCGCTGCAGGCCCGG 0: 1
1: 0
2: 2
3: 39
4: 395
Right 1049803534 8:144528888-144528910 GTCCGGAGCGTCCCGCAAGGCGG 0: 1
1: 0
2: 0
3: 1
4: 23
1049803521_1049803534 9 Left 1049803521 8:144528856-144528878 CCCGGGCTCCCCGCGACCGCGCC 0: 1
1: 0
2: 3
3: 35
4: 325
Right 1049803534 8:144528888-144528910 GTCCGGAGCGTCCCGCAAGGCGG 0: 1
1: 0
2: 0
3: 1
4: 23
1049803518_1049803534 21 Left 1049803518 8:144528844-144528866 CCCCGCTGCAGGCCCGGGCTCCC 0: 1
1: 0
2: 6
3: 40
4: 421
Right 1049803534 8:144528888-144528910 GTCCGGAGCGTCCCGCAAGGCGG 0: 1
1: 0
2: 0
3: 1
4: 23
1049803522_1049803534 8 Left 1049803522 8:144528857-144528879 CCGGGCTCCCCGCGACCGCGCCA 0: 1
1: 0
2: 1
3: 20
4: 193
Right 1049803534 8:144528888-144528910 GTCCGGAGCGTCCCGCAAGGCGG 0: 1
1: 0
2: 0
3: 1
4: 23
1049803519_1049803534 20 Left 1049803519 8:144528845-144528867 CCCGCTGCAGGCCCGGGCTCCCC 0: 1
1: 1
2: 6
3: 53
4: 516
Right 1049803534 8:144528888-144528910 GTCCGGAGCGTCCCGCAAGGCGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049803534 Original CRISPR GTCCGGAGCGTCCCGCAAGG CGG Exonic
900886671 1:5420128-5420150 GTCGGGAGCCTGCCCCAAGGAGG - Intergenic
901610810 1:10496419-10496441 GTCCGGAGAGACTAGCAAGGTGG - Intronic
904995535 1:34628515-34628537 GGCCAGAGGGTCCAGCAAGGTGG - Intergenic
909110224 1:71466353-71466375 GTCCAGGGCCTCCAGCAAGGAGG - Intronic
1065069069 10:22003551-22003573 CACCGGAGCGGCCCGCCAGGTGG + Exonic
1065342537 10:24721769-24721791 GTCTTGAGCGTCCTGCAAGTTGG - Intronic
1077342597 11:2032732-2032754 GTCTGCAGGGTCCAGCAAGGGGG - Intergenic
1088597717 11:111452412-111452434 GTCCGGGCCCTCCCGCCAGGGGG + Intronic
1202825583 11_KI270721v1_random:87921-87943 GTCTGCAGGGTCCAGCAAGGGGG - Intergenic
1091591330 12:1844518-1844540 GTCAGGAACTTCCTGCAAGGAGG + Exonic
1149491079 17:57085513-57085535 GTCCGGAGCGTCCCGCCCCCGGG - Intronic
1152362490 17:79839132-79839154 GGCCGGAGCGGCCCGCGAGGAGG - Intronic
1161667444 19:5585866-5585888 TTCCGGAGCCTCCCCCACGGTGG - Intergenic
1184254247 22:43278145-43278167 GTCCGGAATGGCCCTCAAGGTGG - Intronic
952832295 3:37575248-37575270 GTCTGCAGAGTGCCGCAAGGAGG + Intronic
981093562 4:140756649-140756671 GTCCGGAGCGTCCTTCCAGCGGG - Intergenic
1001328536 5:170746294-170746316 GTCCGAAGCGGCCTGCCAGGTGG + Intergenic
1019055773 6:169222268-169222290 CTCCGGCGTGTCCCTCAAGGTGG - Exonic
1019184508 6:170213294-170213316 GTACTGAGCGGCCCCCAAGGCGG + Intergenic
1019184529 6:170213400-170213422 GTACTGAGCGGCCCCCAAGGCGG + Intergenic
1019559300 7:1648006-1648028 GTCCTGGGCATCCCCCAAGGCGG - Intergenic
1030613585 7:111714870-111714892 GTCTGGAGCCACCTGCAAGGTGG + Intergenic
1041713027 8:60910325-60910347 GGCCGCAGCGCCCCGCCAGGTGG - Intergenic
1049803534 8:144528888-144528910 GTCCGGAGCGTCCCGCAAGGCGG + Exonic
1062656076 9:137605224-137605246 GTCCCGTGCGTCCCCCACGGAGG - Intergenic