ID: 1049808499

View in Genome Browser
Species Human (GRCh38)
Location 8:144552302-144552324
Sequence CAGCAGCAGGGACGCGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 122}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049808499_1049808508 26 Left 1049808499 8:144552302-144552324 CCAGAAGCGCGTCCCTGCTGCTG 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1049808508 8:144552351-144552373 CTGCAGAGCCTGGACGGAGCTGG No data
1049808499_1049808505 20 Left 1049808499 8:144552302-144552324 CCAGAAGCGCGTCCCTGCTGCTG 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1049808505 8:144552345-144552367 CTGTCCCTGCAGAGCCTGGACGG No data
1049808499_1049808504 16 Left 1049808499 8:144552302-144552324 CCAGAAGCGCGTCCCTGCTGCTG 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1049808504 8:144552341-144552363 GCTGCTGTCCCTGCAGAGCCTGG No data
1049808499_1049808509 27 Left 1049808499 8:144552302-144552324 CCAGAAGCGCGTCCCTGCTGCTG 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1049808509 8:144552352-144552374 TGCAGAGCCTGGACGGAGCTGGG No data
1049808499_1049808502 -6 Left 1049808499 8:144552302-144552324 CCAGAAGCGCGTCCCTGCTGCTG 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1049808502 8:144552319-144552341 CTGCTGTCGCTCCTGAGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049808499 Original CRISPR CAGCAGCAGGGACGCGCTTC TGG (reversed) Intronic
901075786 1:6554119-6554141 CAGCAGCAGCAACGCGCGGCCGG + Exonic
901919394 1:12525590-12525612 CAACACCAGGGACTGGCTTCTGG - Intergenic
902410334 1:16208268-16208290 CAGCAGCAGGGAGGAGGTTGGGG - Intronic
902748604 1:18490497-18490519 CAGCAGCGGGGAGGCTCTTGGGG - Intergenic
905886028 1:41492486-41492508 TAGCATCAGGGAAGGGCTTCTGG - Intergenic
906107753 1:43304959-43304981 CAGCAGCAGGGGCGGGCCCCAGG - Exonic
907603517 1:55793777-55793799 CTGCAGCAGGGAAGCGCGGCTGG + Intergenic
919916779 1:202144127-202144149 AAGCAGGAGGGACCCGCTGCCGG - Intronic
920269393 1:204751995-204752017 CTGCAGCAGGGAGGCGCAGCTGG + Intergenic
921708136 1:218346917-218346939 CAGCACCAGGGACTTGCTCCAGG + Exonic
922739789 1:228008493-228008515 AGGCCGCGGGGACGCGCTTCGGG + Intronic
1062823389 10:551206-551228 AAGCATCAGGGAGGCGCTTGAGG - Intronic
1064561392 10:16598247-16598269 CAGCAGGAGGGACCAGCTGCAGG + Intronic
1066063683 10:31746337-31746359 CAGGAGCAGGCAGGGGCTTCTGG + Intergenic
1070327007 10:75396020-75396042 CAGCAGCGGCCACGCGCTCCTGG - Intergenic
1072809336 10:98446917-98446939 CAGGAGCCCGGGCGCGCTTCCGG + Exonic
1072861835 10:99014126-99014148 CAGTAGCAGGGACTCGCGTGTGG - Intronic
1079061749 11:17254967-17254989 CAGCCTCAGGCACGCCCTTCAGG - Intronic
1079181027 11:18193700-18193722 CAGCAACATGGAAGGGCTTCTGG - Intronic
1082234597 11:49808534-49808556 CAGCAGCACGGACTCACTTCTGG - Intergenic
1082658417 11:55879550-55879572 CAGCAGCACGGACTCACTCCTGG - Intergenic
1084014465 11:66370494-66370516 AAACAGCAGGGAGGCTCTTCAGG - Intronic
1086696217 11:89849106-89849128 CAGCAGCACGGACTCACTCCTGG - Intergenic
1086709939 11:89995383-89995405 CAGCAGCACGGACTCACTCCTGG + Intergenic
1089271589 11:117305306-117305328 CAGCAGCGGGGAGGGGCTTATGG + Intronic
1089849781 11:121486246-121486268 CAGGAGCAGGGACCGGCCTCCGG + Intronic
1091657014 12:2353396-2353418 CAGCAGCATAGAAGCGCTCCTGG - Intronic
1092906104 12:13101584-13101606 CGGCAGAGGGGACGCGCCTCAGG - Intronic
1095944651 12:47746948-47746970 CTGCAGCAGGGAGGCCCTTGGGG + Intronic
1097794107 12:63844182-63844204 CAGCAGCGGGGACTCGCGTCAGG + Intergenic
1097895953 12:64824995-64825017 CAGCAGCCGGGGCGCGGTCCGGG - Exonic
1100847726 12:98678337-98678359 CTGCAGCAGGGAGGCGCAGCTGG + Intronic
1106576483 13:30979677-30979699 CTGCAGCAGGGAAGCGCAGCTGG - Intergenic
1110211615 13:72980355-72980377 CAGCATCAGTGACGAGCATCAGG + Intronic
1113780306 13:112972943-112972965 CAGCAGCACGGAGGGGCTTTGGG + Intronic
1113802348 13:113093141-113093163 CAGCAGCAGGGACTGGCCTGTGG - Intronic
1114224600 14:20726017-20726039 CAGCAGTAGGGACTAGCTGCGGG - Intergenic
1119297274 14:73543121-73543143 CAGCAGCCGTGATGCCCTTCAGG - Exonic
1119301505 14:73574979-73575001 CAGCAGCCGTGATGCCCTTCAGG - Exonic
1122562847 14:102629140-102629162 CAGCAGCAAGGAGGCACTTCAGG - Intronic
1132517379 16:372092-372114 CAGCAGCAAGGCTGCGCTCCCGG + Exonic
1132646041 16:999771-999793 CAAGAGCAGGGAGGCTCTTCCGG + Intergenic
1139796981 16:69491085-69491107 CATCAGCAGGGACACCCTCCAGG + Intergenic
1143451272 17:7038308-7038330 CAGCAGCAGGGACCCCCTCCAGG - Exonic
1143586539 17:7853427-7853449 AGGCTGCAGGGACGGGCTTCGGG + Exonic
1145161893 17:20580503-20580525 CAGCAGCAGGGCTGTGGTTCCGG - Exonic
1145839811 17:27984933-27984955 CAGCATCAGGGTGGGGCTTCAGG - Intergenic
1148156044 17:45425707-45425729 CAGCAGCAGGGGCGGGCTCCAGG + Intronic
1150387710 17:64774316-64774338 CAGCAGCAGGGGCGGGCTCCAGG + Intergenic
1151534978 17:74733981-74734003 ACGCAGCAGGGAAGTGCTTCAGG + Intronic
1151542805 17:74773405-74773427 CAGCCACAGGGACTGGCTTCAGG + Intronic
1152216224 17:79034203-79034225 CAGCAGCGGGGACGCCCTCGGGG - Intronic
1156112489 18:33745026-33745048 CTGCACCAGGGACTCTCTTCAGG - Exonic
1158482224 18:57831935-57831957 CAGCAGCAGTAACCCGCCTCGGG - Intergenic
1159896693 18:74003309-74003331 CAGCAGCAAGAACGAGCTCCAGG - Intergenic
1160160687 18:76467602-76467624 GAGCAGCAGGGACTCCCCTCTGG - Intronic
1160364342 18:78311660-78311682 CAGGAACAGGGACGTGCTTCAGG - Intergenic
1160553584 18:79711883-79711905 CATCAGCAAGGACGGACTTCCGG - Intronic
1161173351 19:2824413-2824435 CAGCAGCAGGGAGGTGCCACCGG - Intronic
1161477446 19:4494355-4494377 CAGCAGCGGGGACGAGCTCAGGG + Exonic
1162034347 19:7931350-7931372 CACCAGCAGGGACGGGCCTGGGG - Intronic
1164732298 19:30515563-30515585 CAGCAGCAGGAAGGCACCTCAGG + Intronic
1166104335 19:40589985-40590007 GAGCAGCTGGGACGGGCCTCAGG + Intronic
1166843588 19:45713027-45713049 CAGCAGCAGGGGGGCCCTCCCGG + Exonic
926150244 2:10421817-10421839 CAGCAGCAGTGGCCCGCCTCAGG + Intronic
936045960 2:109188193-109188215 CTGCAGCAGGAAAGCCCTTCGGG - Intronic
937436159 2:121883280-121883302 AAGAAGCAGGGACGGGGTTCGGG - Intergenic
941112281 2:161428121-161428143 GAGCAGCGGGGACGGGCGTCCGG + Intronic
943023957 2:182606813-182606835 CAGCAGAGGGGAAGCTCTTCAGG + Intergenic
943827586 2:192414828-192414850 CTGCAGCAGGCACCCGTTTCTGG - Intergenic
946401580 2:219471392-219471414 CAGCTGCAGGGAAGCCCTCCAGG - Intronic
948529511 2:238595403-238595425 AAGCAGCAGGGAAGAGATTCTGG - Intergenic
948828547 2:240586319-240586341 CGGAAGCAGAGACGCGTTTCGGG + Intergenic
1168914777 20:1476739-1476761 CAGGAGCAGGGCCGAGCATCAGG + Intronic
1171103353 20:22407734-22407756 CTGCAGCAGGGAGGAGCTGCTGG + Intergenic
1172845174 20:37925852-37925874 CGGGAGCAGGGAGGGGCTTCAGG - Intronic
1173785759 20:45791894-45791916 CAGCTCCAGCGTCGCGCTTCCGG + Exonic
1176083064 20:63283598-63283620 CAGCTGCAGGGACGCCCATCTGG + Intronic
1176305455 21:5120785-5120807 CTGCAGCAGGGACCTCCTTCAGG + Intronic
1178930191 21:36811512-36811534 CAGCAGCAGGGAGGGCATTCGGG - Intronic
1179382466 21:40912065-40912087 CTGCAGCAGGGACCCTCTGCTGG - Intergenic
1179851600 21:44141246-44141268 CTGCAGCAGGGACCTCCTTCAGG - Intronic
1184443841 22:44535750-44535772 CAGCAGCAGGGACGCCCCCGTGG + Intergenic
1184773175 22:46609873-46609895 CAGCAGCCGGGCCGCCCCTCAGG - Intronic
1185263304 22:49883394-49883416 GTGCAGCAGAGACGTGCTTCTGG - Exonic
950155685 3:10719948-10719970 GAGCAGCAGGGATGCTTTTCTGG + Intergenic
955241483 3:57182515-57182537 CAGCAGCAGAGAGGAGCTACTGG - Intergenic
956692296 3:71889462-71889484 CACCAGCTGGGAAGCTCTTCTGG + Intergenic
959581848 3:107990732-107990754 CAGCAGAAGGATAGCGCTTCAGG + Intergenic
962971915 3:140408998-140409020 CAGCTGCAGGGGCGAGCTGCAGG - Intronic
966904145 3:184509445-184509467 CAGCAGCACGAACGTGCTTTGGG - Intronic
967258103 3:187613708-187613730 CAGCAGCAGGGAGGAGGCTCTGG + Intergenic
969457578 4:7308886-7308908 CAGCAGCAGAGACACACCTCTGG + Intronic
969671652 4:8593209-8593231 CAGCAGCAGGGGCGCCCTGCAGG + Intronic
970124696 4:12796221-12796243 CAGCAGCAGCAATGCCCTTCTGG - Intergenic
972203730 4:36747308-36747330 CTGCAGCAGGGAGGCGCTGCTGG + Intergenic
975861350 4:78680444-78680466 GAGAAGCAGGGACCCACTTCTGG + Intergenic
983216505 4:165007419-165007441 CAGCAGCAAGGTCGCACTTAGGG - Intergenic
983296327 4:165873472-165873494 CAGCAGCGGGGACGCGGCGCGGG + Exonic
985894507 5:2740456-2740478 CAGCGGCAGCGCCGCGCTTGGGG + Intergenic
990023575 5:51159344-51159366 CTGCAGCAGGGAGGCGCTGATGG + Intergenic
990510068 5:56481612-56481634 GAGCAGCAGGGACCAGCTGCTGG - Exonic
997841611 5:137246138-137246160 CAGCAGAATGGACACACTTCAGG + Intronic
998523183 5:142818782-142818804 CAGCAGGAGGGAAGAGCTCCAGG + Intronic
1001332691 5:170773338-170773360 CAGCAGCAGGGCAGCACCTCTGG + Intronic
1001931039 5:175673129-175673151 CAGCAGCAGGGAGGCTGGTCAGG + Intronic
1004304319 6:14486962-14486984 CCGCAGCAGGGAGGTGCTGCTGG + Intergenic
1005344695 6:24877774-24877796 CAGCAGTAGGGCCATGCTTCAGG - Intronic
1005677415 6:28169199-28169221 CAGCAGAAGTGAAGGGCTTCAGG + Intergenic
1007320889 6:41028197-41028219 CAGCAGCAGGCGCGCCCTTCCGG - Exonic
1010282966 6:74041540-74041562 CAGCTGCAGGGACTCCCTGCAGG - Intergenic
1011284163 6:85706110-85706132 CAGCAGCAGGAAGGAGCTGCAGG - Intergenic
1011635892 6:89372800-89372822 CAGCAGCTGGGACACTCTCCAGG + Intronic
1015512073 6:134047918-134047940 CAGCAGCAGACACACGCTGCAGG - Intronic
1018065113 6:160119102-160119124 CAGCAGCAGGGAGGCGTGGCTGG - Intergenic
1018788981 6:167131584-167131606 CTGCAGCAGGGGCGCGGCTCTGG - Intronic
1019613862 7:1949989-1950011 CAGCAGCAGGGACAGGCTGGGGG + Intronic
1023908811 7:44539856-44539878 CAGCTGCAGGGACGCGCACACGG + Exonic
1024619224 7:51143148-51143170 CAGCAGCAGAGAAGAGCATCAGG + Intronic
1026359781 7:69592148-69592170 CTGCAGCAGGGAAGCGCAGCTGG - Intergenic
1026811577 7:73471266-73471288 CAACAGCAGGGACGCACTTGTGG + Intronic
1030514233 7:110520143-110520165 CTGCAGCAGGGAAGCGCAGCCGG - Intergenic
1031393671 7:121247079-121247101 CAGCAGCATGGAGGCTCTTTAGG + Intronic
1034786341 7:153929164-153929186 CTGAAGCAGGGACACCCTTCAGG + Intronic
1035202230 7:157275085-157275107 CAGCAGCATGGGTGCGCCTCAGG + Intergenic
1036658409 8:10692223-10692245 CAGCAGCAGCCAAGAGCTTCTGG + Intronic
1037291398 8:17352877-17352899 CAACAGCATGGAGGCTCTTCAGG + Intronic
1044428980 8:92086686-92086708 CAGAAGCTGGGACTCACTTCAGG - Intronic
1047911707 8:129536842-129536864 CAGAAGCAGGAACGTACTTCAGG + Intergenic
1049463635 8:142741311-142741333 CAGCAGCAGGCAGGCGCTGCAGG - Intronic
1049594323 8:143476499-143476521 CAGCTGCAGGGAGGTGCCTCTGG - Intronic
1049808499 8:144552302-144552324 CAGCAGCAGGGACGCGCTTCTGG - Intronic
1060921503 9:127423738-127423760 CTGCAGCAGGGAAGCCCTTAAGG + Intergenic
1062034967 9:134378937-134378959 CAGCAGCAGGACCTCTCTTCCGG - Intronic
1062063691 9:134514530-134514552 CAGCACCAGGGCAGCGTTTCTGG + Intergenic
1200244721 X:154516740-154516762 AGACAGCAGGAACGCGCTTCTGG - Intergenic