ID: 1049808500

View in Genome Browser
Species Human (GRCh38)
Location 8:144552314-144552336
Sequence TCTCAGGAGCGACAGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 178}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049808500_1049808511 27 Left 1049808500 8:144552314-144552336 CCCTGCTGCTGTCGCTCCTGAGA 0: 1
1: 0
2: 0
3: 16
4: 178
Right 1049808511 8:144552364-144552386 ACGGAGCTGGGAGAAGCGCGCGG No data
1049808500_1049808512 30 Left 1049808500 8:144552314-144552336 CCCTGCTGCTGTCGCTCCTGAGA 0: 1
1: 0
2: 0
3: 16
4: 178
Right 1049808512 8:144552367-144552389 GAGCTGGGAGAAGCGCGCGGCGG No data
1049808500_1049808504 4 Left 1049808500 8:144552314-144552336 CCCTGCTGCTGTCGCTCCTGAGA 0: 1
1: 0
2: 0
3: 16
4: 178
Right 1049808504 8:144552341-144552363 GCTGCTGTCCCTGCAGAGCCTGG No data
1049808500_1049808509 15 Left 1049808500 8:144552314-144552336 CCCTGCTGCTGTCGCTCCTGAGA 0: 1
1: 0
2: 0
3: 16
4: 178
Right 1049808509 8:144552352-144552374 TGCAGAGCCTGGACGGAGCTGGG No data
1049808500_1049808505 8 Left 1049808500 8:144552314-144552336 CCCTGCTGCTGTCGCTCCTGAGA 0: 1
1: 0
2: 0
3: 16
4: 178
Right 1049808505 8:144552345-144552367 CTGTCCCTGCAGAGCCTGGACGG No data
1049808500_1049808508 14 Left 1049808500 8:144552314-144552336 CCCTGCTGCTGTCGCTCCTGAGA 0: 1
1: 0
2: 0
3: 16
4: 178
Right 1049808508 8:144552351-144552373 CTGCAGAGCCTGGACGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049808500 Original CRISPR TCTCAGGAGCGACAGCAGCA GGG (reversed) Intronic
900959351 1:5909350-5909372 GTTCAGGGGCAACAGCAGCAAGG + Intronic
901736205 1:11313696-11313718 TCTCAGCAGTGACTGGAGCATGG + Intergenic
903008659 1:20315199-20315221 TCTCGTGGGCGAAAGCAGCAGGG + Intronic
903380715 1:22895376-22895398 TCCCAGGAGACCCAGCAGCATGG + Intronic
903889576 1:26560627-26560649 GCTCAGTAGAGACAGCACCAGGG - Intronic
904401461 1:30259392-30259414 TACCAGGAGAGAAAGCAGCAGGG + Intergenic
906792104 1:48668200-48668222 TCGCTGTAGCAACAGCAGCATGG + Intronic
907404505 1:54245611-54245633 TCTCAGGAGCAACACCAGGCTGG + Intronic
908116079 1:60941498-60941520 TCCCAGGAGGGAAAGCATCAAGG + Intronic
909349743 1:74637362-74637384 TATCAGGAGCCACAGCACCCAGG - Intronic
909940017 1:81600512-81600534 TCTCAAGAACACCAGCAGCAGGG + Intronic
913189971 1:116405213-116405235 TCTCTGGAGGGAAAGCAGGAAGG - Intronic
913212736 1:116595032-116595054 TCTCAGCAGCCTCACCAGCATGG + Intronic
913374110 1:118132167-118132189 ACTCAGGAGTGACACCTGCAGGG - Intronic
919306914 1:195853224-195853246 CCTCAGCAGCAATAGCAGCAAGG - Intergenic
923522915 1:234749948-234749970 TCTCAGGTTCCACAGCAGCTGGG + Intergenic
923684409 1:236143638-236143660 TCTGATGAGCGGCAGCAGCTCGG - Intronic
1063363866 10:5478153-5478175 TCTCTGCAGAGACTGCAGCAAGG - Intergenic
1065826195 10:29574108-29574130 TCTCAGTGGACACAGCAGCAGGG - Intronic
1065951177 10:30652514-30652536 TCTCAGTGGACACAGCAGCAGGG + Intergenic
1068628393 10:59274134-59274156 TCTCAGGACAGACAGCAGGGAGG + Intronic
1069769227 10:70887316-70887338 TTTCAGGAGGGAAAACAGCAGGG - Intronic
1072298405 10:94035358-94035380 GCTCAGAAGAAACAGCAGCAGGG - Intronic
1075745578 10:124725033-124725055 TCTGAGGAGCGAGAGTAGAAGGG + Intronic
1076583935 10:131532696-131532718 TCTAAGCACCGACACCAGCAAGG - Intergenic
1077548895 11:3190694-3190716 CCTCAGAAGTCACAGCAGCAAGG - Intergenic
1078095646 11:8295042-8295064 TCTCCGTTGAGACAGCAGCAAGG + Intergenic
1078366994 11:10715124-10715146 TCTCAGGGGCTACAGCCACAGGG + Intergenic
1079077157 11:17391055-17391077 TCTCAGAAGGGTGAGCAGCAGGG - Intergenic
1079312356 11:19378071-19378093 TCTCCAGAGAGACAGGAGCAGGG + Intronic
1081699692 11:45145440-45145462 TCTGCGGATCGCCAGCAGCAAGG + Intronic
1082010940 11:47449190-47449212 TCTGAGGAATGTCAGCAGCAAGG + Intergenic
1082997527 11:59265621-59265643 GCTCAGGAACACCAGCAGCAGGG - Intergenic
1083924423 11:65797431-65797453 TCTCAGCAGCGGCAGCAGCGGGG + Intergenic
1087036089 11:93758150-93758172 TCTCTGGAGCGGCTGCAGCAGGG + Intronic
1089011510 11:115135829-115135851 ACTCAGGAGGCAAAGCAGCAGGG - Intergenic
1089337082 11:117732651-117732673 TTTCAGAAGTGACAGCAGCCTGG - Intronic
1089347732 11:117801809-117801831 TCTCAGCAGTGACACCAGGATGG + Intronic
1089750134 11:120645714-120645736 TCTCAGGAACCACAGAAGAAAGG - Intronic
1089845383 11:121454148-121454170 TCTTAACAGCGACACCAGCATGG + Intronic
1090383344 11:126342296-126342318 GCTCAGGAAGGACAGCAGGAAGG + Intronic
1091126816 11:133107432-133107454 TATCAGGAGCTCCAGAAGCATGG - Intronic
1092765691 12:11850788-11850810 ACTGAGGAAAGACAGCAGCATGG - Intronic
1094395449 12:30000525-30000547 TTTCAGGAGAGACAGCCACAAGG - Intergenic
1096225717 12:49865654-49865676 TCTCAGGACCCACGGCTGCACGG + Intergenic
1100949307 12:99828171-99828193 TCTCAGGAAGAACAGCAGAATGG + Intronic
1101098552 12:101368923-101368945 TCTCAGCAGCCAGAGCAGCACGG + Intronic
1101211464 12:102539117-102539139 TTTCAGCAGCAGCAGCAGCAGGG + Intergenic
1101711064 12:107267407-107267429 TGTCAGGAGCCAAAGCAGCTTGG + Intergenic
1104936413 12:132366668-132366690 TCACAGGTGCGAGAGCAGGAGGG + Intergenic
1105215986 13:18285663-18285685 TCTCAGCAGCCTCACCAGCATGG + Intergenic
1108530499 13:51323260-51323282 GCTCAGGAGGGGCAGAAGCAAGG - Intergenic
1108715527 13:53074664-53074686 ACTCTGCAGCGACAGCAGCCAGG + Intergenic
1112980199 13:105374765-105374787 TCTCTGGAGTGACAGGTGCAAGG - Intergenic
1113375376 13:109760572-109760594 TGTCACAAGCGACAGCAGAAAGG - Intronic
1113401599 13:109999341-109999363 TCCCAGGATTGACAGCAGGAAGG + Intergenic
1119520504 14:75281046-75281068 TGTCAAGAGCATCAGCAGCATGG + Exonic
1121016730 14:90553453-90553475 GCCCATGAGGGACAGCAGCAGGG - Intronic
1121492748 14:94371852-94371874 CCTGAGGAGGGACAGCAGGAGGG - Intergenic
1122233002 14:100316403-100316425 GCTCAGGAACGCCAGCAGCAGGG + Intergenic
1124437192 15:29660371-29660393 TCACAGGATGGACAGCAGAAGGG - Intergenic
1125018207 15:34958301-34958323 GCTCAGGAGTGAGAGCAGCCTGG + Intronic
1128780321 15:70354810-70354832 TCCCAGAACCGCCAGCAGCATGG + Intergenic
1129144347 15:73633418-73633440 GCTGAGGAGCGACCGCCGCAAGG + Intronic
1129831825 15:78675745-78675767 TCTCAGTGGTGACACCAGCAGGG + Intronic
1129929705 15:79400170-79400192 TGTGAGGAGTGACAGCAGAATGG - Intronic
1132120969 15:99175065-99175087 TCCCTGAAGCGACAGCAGCATGG + Exonic
1132686440 16:1164106-1164128 TCCCAGAAGCCACAGAAGCAAGG + Intronic
1132838904 16:1968717-1968739 CCGCAGGAGGGACAGCAGCAGGG - Exonic
1134597977 16:15511070-15511092 TCCCAGGAGCCACCACAGCATGG + Intronic
1141777962 16:86136812-86136834 TCTCAGCAGGGAGAGCAGGAAGG + Intergenic
1141890243 16:86921526-86921548 TCTTAGCAGCCACAGCAGTAAGG - Intergenic
1142008133 16:87700053-87700075 GCCCAGGAGCGCCAGCAGCTTGG - Intronic
1144733054 17:17539870-17539892 TCTCAGGAGCGTGGGCAGGAGGG + Intronic
1146188472 17:30744050-30744072 TCTAAGGAGAAACAGCAGCTTGG + Intergenic
1146333346 17:31948367-31948389 TCTAAGGAGAAACAGCAGCTTGG + Intronic
1147607850 17:41784597-41784619 TCTGGGGAGCAACAGGAGCAGGG - Intronic
1150298154 17:64025931-64025953 GCTCAGGGTCGACAGGAGCAGGG + Intergenic
1151621604 17:75248903-75248925 TCTGAGTAGCGACAGCTGCCAGG + Intronic
1152730710 17:81968269-81968291 TCTAAGGAGCAACTGCAGCCAGG - Intergenic
1152970671 18:158487-158509 GCTCCGGAGCGACTGCAGCGAGG - Intronic
1156501345 18:37561155-37561177 GCCCAGGAGCCACAGCTGCAGGG - Intronic
1157440584 18:47708593-47708615 TTTCAGGAGGCACAGCAGCATGG + Intergenic
1158256003 18:55549628-55549650 TGTCAGGGGCAACAACAGCATGG + Intronic
1158351827 18:56572053-56572075 TCTAGGGAGGGACAGCAGCAAGG + Intergenic
1160344617 18:78123193-78123215 TCTCCTGAGCGCCTGCAGCAGGG + Intergenic
1161404351 19:4083299-4083321 TGTCAGGGGAGACAGCAGGATGG + Intergenic
1163261305 19:16191776-16191798 TCTCAGGGGTGACAGGACCAGGG + Exonic
1163821343 19:19498266-19498288 TCTCAGAAGCCAGGGCAGCAGGG - Intronic
1164161430 19:22627825-22627847 TCTCAGCAGCAGCAGCAGCTTGG + Intergenic
1165155661 19:33785809-33785831 TGGCAGGAGCAACAGCAGCTAGG - Intergenic
1165324133 19:35104414-35104436 TCTCAGCAGTGGCAGGAGCAGGG + Intergenic
1166169749 19:41019437-41019459 TTTTAAGAGCGACAGCAGAATGG + Intergenic
1167867564 19:52340561-52340583 TCTCAGGATCAGCAGCAGCCAGG - Intronic
1168240759 19:55087765-55087787 TCTCCGGAGGGACTGCAGCAAGG - Exonic
926174120 2:10573854-10573876 GCTTAGGAGCGGCAGCAGCCTGG - Intronic
926240214 2:11079648-11079670 ACACGGGAGTGACAGCAGCAGGG + Intergenic
926458672 2:13100503-13100525 TTTCAGGAGTGACATCAGCAAGG - Intergenic
928249707 2:29664721-29664743 TATCAGGAGTGACAGCATAATGG + Intronic
933117911 2:78497797-78497819 TCTCTGGAGGCACATCAGCAGGG - Intergenic
934063759 2:88320697-88320719 TCCCAGGAGTTACAGCAGCTTGG - Intergenic
934298342 2:91761063-91761085 TCTCAGCAGCCTCACCAGCATGG - Intergenic
934587701 2:95517994-95518016 CCTCAGGACCCTCAGCAGCAGGG + Intergenic
935094833 2:99934527-99934549 TCTCAAGAACCACAGAAGCAGGG + Intronic
936461942 2:112720862-112720884 TCTCTAGAGCAAAAGCAGCAAGG - Intergenic
937704433 2:124902991-124903013 TCACAGGCGCGACAGTGGCATGG - Exonic
938083045 2:128380441-128380463 CCTCAGGAGCCGCTGCAGCACGG - Intergenic
940610589 2:155986194-155986216 ACTGAGGAGGGAAAGCAGCAGGG + Intergenic
942129276 2:172862390-172862412 GCTGAGCAGAGACAGCAGCAAGG + Intronic
943811660 2:192195335-192195357 TCAGAGGAGCAGCAGCAGCAGGG + Exonic
946035651 2:216740242-216740264 TCTGAGAAGCCACAGCAGCCAGG - Intergenic
946727138 2:222671844-222671866 TTTCAGGACCCACTGCAGCACGG - Exonic
947796286 2:232896083-232896105 TCCCAGGAGGGACAGCAGAGTGG + Intronic
1169260510 20:4134899-4134921 TCTCAGAAGGGACAGCAGGGTGG + Intronic
1171131189 20:22654116-22654138 TCTCAGGCTCCCCAGCAGCAAGG - Intergenic
1171891798 20:30724281-30724303 TCTCAGGAGCGCCGCCAGCCCGG + Intergenic
1173023212 20:39285039-39285061 TCTCAGGTGCCACAGCAGTGTGG - Intergenic
1173421175 20:42902429-42902451 GCTCAGGAGAGACAGAAGCCAGG + Intronic
1173868878 20:46329769-46329791 GCTCAGGAGCCGCAGCAGCCAGG - Intergenic
1174579213 20:51559137-51559159 TCTCAGTACAGAAAGCAGCATGG + Intronic
1175712997 20:61235931-61235953 TCTCAGCAACCCCAGCAGCAGGG - Intergenic
1178228124 21:30748239-30748261 TCTCAGGAGAGGATGCAGCAGGG - Intergenic
1178268982 21:31172168-31172190 GCTGAGGAGAGACACCAGCATGG + Intronic
1178758409 21:35376029-35376051 TCACAGGAGCGAGAGTAGAAAGG - Intronic
1179348507 21:40584427-40584449 TCTCAGAAGCGTCGGCAGCAGGG + Intronic
1179361310 21:40711844-40711866 TCTCAAGAGAGACATCAGCAAGG - Intronic
1180624636 22:17186069-17186091 TTTCAGGAGGAACAGCAGCCAGG + Intronic
1182712505 22:32331724-32331746 TCGCAGGAGCGACAGGCGGAGGG + Intergenic
1182756975 22:32688245-32688267 TCTCATGAGCCACAGACGCATGG - Intronic
1184781726 22:46652996-46653018 TTTCGGGAGAGACAGCAGCTTGG + Intronic
949458285 3:4262639-4262661 TCTCAGCAGCCCCAGCAGAAAGG + Intronic
949646165 3:6096930-6096952 CGTCAGGAGAGACAGGAGCAAGG - Intergenic
950435147 3:12974894-12974916 GCTCAGGGGCGACAGCTGCAAGG - Intronic
950654581 3:14428679-14428701 TCTCAGGAGACTCAGCAGCCTGG - Intronic
952500296 3:33955551-33955573 TCTCAGGAGCTACACCTGTAAGG - Intergenic
953738468 3:45516230-45516252 TCTCAGGAGGGGCAGCAAAAAGG - Exonic
957482500 3:80816454-80816476 TCTCAGCAGCAGCACCAGCACGG - Intergenic
962101673 3:132349219-132349241 CCTCAGGAGCAACAGCAGTTAGG + Intronic
962331725 3:134484718-134484740 TCCCAGGAGACAGAGCAGCAAGG - Intronic
968344028 3:197984976-197984998 TATCAGAAGCGGCAGCAGAAGGG - Intronic
969899327 4:10334084-10334106 GCTCAGGATCCACTGCAGCAGGG + Intergenic
972612562 4:40669082-40669104 TTTCAGGAGCAACAGAATCAAGG - Intergenic
973774396 4:54231344-54231366 TGTCAGGAGCGACCGCGGCGAGG - Intronic
974309202 4:60183072-60183094 TCTCAGGAGGGATAGAAGTAAGG - Intergenic
975722620 4:77262894-77262916 TCTCATGAGCAGCATCAGCATGG - Intronic
979576516 4:122297902-122297924 TGTCAGCAGGGACAGCAGGAGGG + Intronic
981940982 4:150281407-150281429 TCCCAGGAGACAGAGCAGCAAGG + Intronic
984502127 4:180569976-180569998 TGACAGGAGCGATAGCAGAAGGG + Intergenic
985978087 5:3437995-3438017 TCACAGGAGAGACTGCAGGAGGG + Intergenic
990349144 5:54898432-54898454 TTTAAGCAGAGACAGCAGCATGG - Intergenic
991777256 5:70097234-70097256 TCTCAGGAGGGAGAGCGACAGGG + Intergenic
991856542 5:70972677-70972699 TCTCAGGAGGGAGAGCGACAGGG + Intronic
1000111572 5:158113059-158113081 GCTCAGGAGTGACAGAAGCCAGG - Intergenic
1000846523 5:166288653-166288675 TCTCAGGAGCCATGGCAGGATGG - Intergenic
1001639817 5:173236349-173236371 TTTCAGGAGCGCCAGCTACATGG + Intergenic
1001881594 5:175249473-175249495 TATTAGGAAGGACAGCAGCAGGG + Intergenic
1003458046 6:6301973-6301995 TCTCAGGATCAACATCTGCAAGG - Intronic
1003973306 6:11320058-11320080 TCCCAGGAGGGACAGCATCCAGG - Intronic
1005813180 6:29531410-29531432 TTTCAGGAGTGAGAGCAGGAGGG - Intergenic
1015674854 6:135734152-135734174 TCTCAGGATTGACAGCTGTAGGG - Intergenic
1017382688 6:153848502-153848524 TCTCAGGAGGTACAGCTGCCAGG + Intergenic
1018765136 6:166926915-166926937 TCTCAGGATGGAGAGCAGCCAGG - Intronic
1019753553 7:2750188-2750210 TCACAGCAGCGACACCGGCAAGG + Intronic
1020069824 7:5219513-5219535 TCTGTGGAGTGAGAGCAGCAAGG + Intronic
1026145592 7:67743828-67743850 TCTCAGTAGAGGCAGCAGAAAGG + Intergenic
1027946071 7:84748224-84748246 TTTCAGGACCGACATCAGCAAGG + Intergenic
1031068594 7:117136190-117136212 TCTCAGCAGCTACAACATCATGG + Exonic
1034487429 7:151374689-151374711 CCTCAGGAGTGACAGCAGGTTGG + Intronic
1037799618 8:22025254-22025276 TCTCAGTAGCGCCAGTAGCACGG + Exonic
1039510749 8:38090091-38090113 TCCCAGGAGAAACAGTAGCAAGG - Intergenic
1040456069 8:47599128-47599150 TCCCAGCAGAGACAGCACCAGGG + Exonic
1040610099 8:48975672-48975694 CCCCAGGAGGGACAGGAGCAAGG + Intergenic
1041548506 8:59074762-59074784 TTAAAGGAGCGACAGCAGCGTGG + Intronic
1043064534 8:75550815-75550837 TCTCAGGAGAGACTGCTCCATGG + Intronic
1045200873 8:99979940-99979962 GCTCAGGAGAGAAAGCAGTAAGG + Intronic
1047381891 8:124372131-124372153 CCTCAGCAGCGGCAGCAGCCGGG + Exonic
1048275733 8:133064559-133064581 ACGCTGGAGAGACAGCAGCATGG - Intronic
1048641180 8:136363699-136363721 TCTTAGTAGCCACAGAAGCATGG + Intergenic
1048913272 8:139157173-139157195 TCTCAGGAAATAAAGCAGCATGG - Intergenic
1049083447 8:140459556-140459578 TCTCAGCACATACAGCAGCAAGG + Intergenic
1049531816 8:143159002-143159024 TCCCAGGAGTGCCTGCAGCAGGG - Intronic
1049808500 8:144552314-144552336 TCTCAGGAGCGACAGCAGCAGGG - Intronic
1050928471 9:11296460-11296482 TAGCAGCAGCAACAGCAGCACGG + Intergenic
1051503964 9:17807805-17807827 CCTCAGGAGGGCTAGCAGCAAGG + Intergenic
1057181211 9:93031632-93031654 TCTCAGGAGCCACAGCAGAGGGG - Intronic
1058745726 9:107988866-107988888 TCCCATGAGCAACATCAGCAGGG + Intergenic
1059363967 9:113770920-113770942 TCGCAGGAGCGCCAGCAGTGAGG - Intergenic
1060273301 9:122163418-122163440 TCTGAAGGGCCACAGCAGCAGGG - Intronic
1060936149 9:127517346-127517368 GCTCAGGAGAGAGGGCAGCAGGG - Intronic
1062090946 9:134678598-134678620 GCTCAGGAATGACAGCAGCCAGG - Intronic
1062385295 9:136306960-136306982 TCCCAGGAGCCCCAGCAGCCAGG - Intergenic
1203561163 Un_KI270744v1:59865-59887 TCACAGGAGCGCCACCAGCCCGG + Intergenic
1189677207 X:43473537-43473559 TCCCAGGAGGGAAAGCATCAAGG + Intergenic
1190652073 X:52577225-52577247 TCTCAGGAGAAGGAGCAGCAAGG - Intergenic
1198805445 X:140489812-140489834 CCTGAGTAGCTACAGCAGCAAGG - Intergenic