ID: 1049808501

View in Genome Browser
Species Human (GRCh38)
Location 8:144552315-144552337
Sequence TTCTCAGGAGCGACAGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 178}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049808501_1049808512 29 Left 1049808501 8:144552315-144552337 CCTGCTGCTGTCGCTCCTGAGAA 0: 1
1: 0
2: 2
3: 14
4: 178
Right 1049808512 8:144552367-144552389 GAGCTGGGAGAAGCGCGCGGCGG No data
1049808501_1049808511 26 Left 1049808501 8:144552315-144552337 CCTGCTGCTGTCGCTCCTGAGAA 0: 1
1: 0
2: 2
3: 14
4: 178
Right 1049808511 8:144552364-144552386 ACGGAGCTGGGAGAAGCGCGCGG No data
1049808501_1049808505 7 Left 1049808501 8:144552315-144552337 CCTGCTGCTGTCGCTCCTGAGAA 0: 1
1: 0
2: 2
3: 14
4: 178
Right 1049808505 8:144552345-144552367 CTGTCCCTGCAGAGCCTGGACGG No data
1049808501_1049808509 14 Left 1049808501 8:144552315-144552337 CCTGCTGCTGTCGCTCCTGAGAA 0: 1
1: 0
2: 2
3: 14
4: 178
Right 1049808509 8:144552352-144552374 TGCAGAGCCTGGACGGAGCTGGG No data
1049808501_1049808504 3 Left 1049808501 8:144552315-144552337 CCTGCTGCTGTCGCTCCTGAGAA 0: 1
1: 0
2: 2
3: 14
4: 178
Right 1049808504 8:144552341-144552363 GCTGCTGTCCCTGCAGAGCCTGG No data
1049808501_1049808508 13 Left 1049808501 8:144552315-144552337 CCTGCTGCTGTCGCTCCTGAGAA 0: 1
1: 0
2: 2
3: 14
4: 178
Right 1049808508 8:144552351-144552373 CTGCAGAGCCTGGACGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049808501 Original CRISPR TTCTCAGGAGCGACAGCAGC AGG (reversed) Intronic
900989221 1:6090399-6090421 TTCCCTGGAGCGACTGCAGCTGG + Exonic
901049795 1:6420336-6420358 CTCCCATGAGGGACAGCAGCGGG + Intronic
901495849 1:9621363-9621385 TTATCAGAAGAGACAGCAGAGGG + Intergenic
902645650 1:17796149-17796171 TGCTCAGTAGCCAGAGCAGCTGG - Intronic
903008658 1:20315198-20315220 TTCTCGTGGGCGAAAGCAGCAGG + Intronic
904716343 1:32470595-32470617 TGCTCTGGAGCAGCAGCAGCTGG + Exonic
905647958 1:39637633-39637655 CTCTGAGGAGAGAAAGCAGCTGG - Intronic
906949342 1:50321950-50321972 TTCTCAGGAGGGATGGCAGGTGG - Intergenic
908118455 1:60963723-60963745 TTCTCAGGAGTGAAGACAGCTGG + Intronic
910916052 1:92290586-92290608 TTCTCAGGGGCTCCAGCAGGTGG + Intronic
911621444 1:100070314-100070336 TTCTCAGGAGAGACTGTAGCTGG + Intronic
912518395 1:110229765-110229787 TTCCCGGGAGCGGCAGGAGCAGG - Intronic
913538370 1:119795710-119795732 TTCTCAGGAGCCACAGAGGATGG + Intronic
914508593 1:148310299-148310321 CTCGCAGAAGCGGCAGCAGCCGG + Intergenic
915543229 1:156581916-156581938 TGCTCAAGAGAGACAGCTGCGGG + Exonic
915996124 1:160565730-160565752 TTCTCAGGGCCGGAAGCAGCTGG - Exonic
917328463 1:173857619-173857641 TCCTCAGGAGGGACAGAATCTGG - Exonic
917408409 1:174733788-174733810 TTCTCTAGAGTGACAGTAGCCGG - Intronic
923522914 1:234749947-234749969 ATCTCAGGTTCCACAGCAGCTGG + Intergenic
923637156 1:235710364-235710386 GCTTCAGGAGCGGCAGCAGCAGG + Intronic
924187871 1:241515285-241515307 GTCTCTGGAGCAGCAGCAGCAGG + Intronic
1063482230 10:6385914-6385936 CTTTCAGGAGCAAGAGCAGCTGG + Intergenic
1064090222 10:12376682-12376704 TTCTCAGGAGTGTGAGCAGGTGG - Intronic
1065806417 10:29397393-29397415 TGCTGAGGAGAGACAGCAGAAGG - Intergenic
1065826196 10:29574109-29574131 TTCTCAGTGGACACAGCAGCAGG - Intronic
1065855926 10:29830016-29830038 CTCTCAGGAGAGAATGCAGCAGG + Intergenic
1065951176 10:30652513-30652535 TTCTCAGTGGACACAGCAGCAGG + Intergenic
1067111475 10:43404191-43404213 TTCTCAGGCTCGTGAGCAGCTGG - Intronic
1067478295 10:46580031-46580053 ATCTCAGGAGTGATAGGAGCAGG - Intronic
1067616444 10:47761756-47761778 ATCTCAGGAGTGATAGGAGCAGG + Intergenic
1067872049 10:49970553-49970575 TTCTCAGAAGGGGCAGCTGCTGG - Intronic
1069769228 10:70887317-70887339 TTTTCAGGAGGGAAAACAGCAGG - Intronic
1071951711 10:90710639-90710661 ATCTCATGAGCGATAGAAGCAGG - Intergenic
1072248888 10:93566579-93566601 TTCTGAGGAGCGCCAGCACTGGG - Intergenic
1073445000 10:103575293-103575315 TTCAGAAGAGAGACAGCAGCGGG - Intronic
1073458163 10:103650185-103650207 AGCTCAGCAGCGGCAGCAGCTGG + Intronic
1075651133 10:124128887-124128909 CTCTCAGGAGGCTCAGCAGCAGG + Intergenic
1075745577 10:124725032-124725054 TTCTGAGGAGCGAGAGTAGAAGG + Intronic
1075910702 10:126123460-126123482 TTCTCTAGAGCGACAGGAGGAGG + Intronic
1083924422 11:65797430-65797452 CTCTCAGCAGCGGCAGCAGCGGG + Intergenic
1084496126 11:69504757-69504779 TTCTCAGGAGTGACAGAGCCGGG - Intergenic
1084803546 11:71563669-71563691 TTCTCAGGCGTGACTGCAGAGGG - Intronic
1085196620 11:74676572-74676594 AGCTCAGGAGAGACATCAGCAGG + Intergenic
1087036088 11:93758149-93758171 CTCTCTGGAGCGGCTGCAGCAGG + Intronic
1087635936 11:100701332-100701354 TTGTTAGGAGCCAAAGCAGCTGG - Intronic
1089213019 11:116819259-116819281 TATGCAGGAGCGAGAGCAGCTGG + Intergenic
1089321858 11:117631809-117631831 TGCTCTGGAGCGACAGAGGCTGG + Intronic
1089490347 11:118879540-118879562 TTCCCAGGTGCTATAGCAGCAGG - Intergenic
1092464926 12:8722562-8722584 TTGTTAGGAGCGAAGGCAGCTGG - Intronic
1093823195 12:23647442-23647464 CTCTTAGGAGCTACTGCAGCTGG - Intronic
1094497220 12:30995863-30995885 TTCCCAGGAGCTGCAGCTGCTGG + Exonic
1096605287 12:52760649-52760671 CAATCAGGAGCCACAGCAGCTGG + Intergenic
1096605326 12:52760867-52760889 TTAGCAGGAGGGACAGCAGAGGG - Intergenic
1101211463 12:102539116-102539138 TTTTCAGCAGCAGCAGCAGCAGG + Intergenic
1105554863 13:21437525-21437547 TTCTCAGGAGCCAATGTAGCTGG + Intronic
1114269557 14:21092497-21092519 TCCTCGGGAGCGGCAGGAGCTGG + Exonic
1116379950 14:44253906-44253928 TGCTCAGGAGTGACAAAAGCAGG - Intergenic
1119781136 14:77277552-77277574 TTCTCTGGAGCTCCAGCAGGAGG - Intronic
1121016731 14:90553454-90553476 TGCCCATGAGGGACAGCAGCAGG - Intronic
1121233199 14:92373342-92373364 TTCTTAGAAATGACAGCAGCTGG - Intronic
1121492750 14:94371853-94371875 TCCTGAGGAGGGACAGCAGGAGG - Intergenic
1121835705 14:97090212-97090234 TTCTCAGGAGAAACAGAACCAGG + Intergenic
1122233001 14:100316402-100316424 GGCTCAGGAACGCCAGCAGCAGG + Intergenic
1128554742 15:68623692-68623714 CTCCCAGGAGCAGCAGCAGCGGG + Intronic
1129149370 15:73678064-73678086 TTCTGAGGAGTGACTCCAGCTGG - Intergenic
1129741557 15:77992056-77992078 TTAGCAGCAGCGGCAGCAGCAGG + Intronic
1130959992 15:88652934-88652956 TGCCCAGGAGCAGCAGCAGCTGG - Intronic
1132838906 16:1968718-1968740 GCCGCAGGAGGGACAGCAGCAGG - Exonic
1134860117 16:17553378-17553400 TACTCAGGAGCTACTGAAGCAGG + Intergenic
1135182636 16:20288948-20288970 TTCTGAGGAGCCTAAGCAGCCGG - Intergenic
1135496602 16:22956905-22956927 TCCCCAGGAGCCACAGCAGATGG - Intergenic
1139175720 16:64684715-64684737 TTCTAGGGAGCGAGAACAGCTGG - Intergenic
1139327645 16:66164566-66164588 TTCTAAGGAGTCACAGCATCTGG - Intergenic
1141270169 16:82532385-82532407 CTCCCAGGAGTGACAACAGCAGG + Intergenic
1141462084 16:84183624-84183646 GTCTCAGGAGCGGGAGCAGTGGG + Intronic
1141586151 16:85034910-85034932 TTCTCAGGAGAGGCAGCACAGGG - Intronic
1141694485 16:85613216-85613238 TCCTCGGCGGCGACAGCAGCAGG + Exonic
1141852162 16:86653853-86653875 TTCCCAGGAGCTGCTGCAGCCGG - Intergenic
1142077564 16:88128890-88128912 TTCTCAGCAGCGGCAGATGCTGG - Intergenic
1142517356 17:441385-441407 TGCCCCGGAGCCACAGCAGCAGG - Exonic
1142624400 17:1182723-1182745 TTCTCAGGACCTTCAGCACCCGG - Intronic
1144012047 17:11158248-11158270 GTCTCAGGAGTGACAGAAGTGGG + Intergenic
1148732219 17:49844231-49844253 ATCTCAGGAGTGACAGCTGGTGG + Intronic
1151656188 17:75497130-75497152 TACTCAGGAGTGGCGGCAGCTGG - Exonic
1152407525 17:80106146-80106168 CTCTCAGGAACGACAGCACTTGG + Intergenic
1155810206 18:30223483-30223505 ATACCAGCAGCGACAGCAGCAGG - Intergenic
1155839077 18:30625550-30625572 TTCTCAGCAGAGAGAGGAGCTGG + Intergenic
1156966259 18:43097233-43097255 TCCTCAGCAGCTACAGCATCTGG - Intronic
1160015288 18:75135432-75135454 ATCTCAGGAGCAGAAGCAGCTGG + Intergenic
1163253305 19:16139734-16139756 TTCTCAGCAGAGGCCGCAGCTGG - Intronic
1165285521 19:34838736-34838758 GTCTCAGGAGCCACTGCTGCCGG - Intergenic
1167231347 19:48285946-48285968 TTCTCAGGGGCAACTGCAGGTGG - Exonic
1167360530 19:49028139-49028161 TACTCAGGAGCCACAGCAGGAGG - Intronic
1167363118 19:49040661-49040683 TACTCAGGAGCCACAGCAGGAGG + Intergenic
1167365449 19:49052925-49052947 TACTCAGGAGCCACAGCAGGAGG - Intergenic
1168478904 19:56700537-56700559 TTCTTAGGAACGAATGCAGCTGG + Intergenic
1168692877 19:58387333-58387355 TTCTCAGGTGAGACCGCCGCGGG + Exonic
925390050 2:3488360-3488382 TGCTCAGCAGCAGCAGCAGCAGG + Intergenic
932175536 2:69597414-69597436 AACTCAGGAGCGATAGCAACAGG - Intronic
932802351 2:74752130-74752152 TTCACAGGACCCACAGCAGAGGG - Intergenic
933240100 2:79910879-79910901 TTCTCTGGAGGGTCAGCAGGAGG - Intronic
933576003 2:84068613-84068635 TTTTCAGGGGCTAAAGCAGCTGG + Intergenic
933839452 2:86274897-86274919 TTTCCATGAGCCACAGCAGCTGG + Intronic
935606510 2:104976801-104976823 TTCTGAGGAGGGACACCAGCTGG + Intergenic
936269790 2:111040988-111041010 AACTGAGGAGCAACAGCAGCAGG + Intronic
940527631 2:154837617-154837639 TCCACAGGAGAGACAGCAGAAGG - Intronic
942812506 2:180015764-180015786 TTCCCAGTAACGACAACAGCTGG - Intergenic
944172275 2:196793137-196793159 TTCTCAGGAGAAACATCAGATGG - Exonic
945138943 2:206663068-206663090 TTATCAGGAGGGACTGAAGCAGG - Exonic
947572797 2:231249167-231249189 CTCTAAGTAGAGACAGCAGCAGG - Intronic
948399572 2:237673854-237673876 GTCTCAGGAGCGCCAGCAGCTGG + Intronic
948432429 2:237928262-237928284 TTCTCAGGAGACCAAGCAGCTGG - Intergenic
948750593 2:240130199-240130221 TTCTCAGTAGCGGGGGCAGCAGG + Intronic
1169867783 20:10219026-10219048 TACCCAGAAGGGACAGCAGCTGG + Intronic
1172012947 20:31857036-31857058 TTATCAAGAGGGACAGAAGCCGG + Intronic
1172828190 20:37808152-37808174 TTTTCAGCAGTGACAGCAGTTGG + Intronic
1173014616 20:39213942-39213964 CTCTCAGGACTGACAGCATCTGG + Intergenic
1173152099 20:40576182-40576204 GTTTCAGAAGCCACAGCAGCTGG + Intergenic
1175712998 20:61235932-61235954 TTCTCAGCAACCCCAGCAGCAGG - Intergenic
1175821737 20:61913676-61913698 TTCTCAGGAGCATCCCCAGCTGG - Intronic
1177677814 21:24324803-24324825 TTTTCAGGATCCACTGCAGCAGG - Intergenic
1178228125 21:30748240-30748262 TTCTCAGGAGAGGATGCAGCAGG - Intergenic
1179348506 21:40584426-40584448 ATCTCAGAAGCGTCGGCAGCAGG + Intronic
1180096629 21:45558341-45558363 TTCTCAGCAGCCAGAGCTGCAGG - Intergenic
1180636784 22:17268174-17268196 ATCTCAGCAGCCACAGCACCAGG + Intergenic
1181413747 22:22745049-22745071 TGCTCAGGAGAGAGTGCAGCAGG + Intronic
1182124924 22:27809407-27809429 GTGTCAGCAGCGACGGCAGCCGG + Intergenic
1184114501 22:42414493-42414515 TACTCAGGAGCCAAAGCAGAAGG + Intronic
1185153922 22:49182070-49182092 TTCTCCGTAGCTCCAGCAGCCGG + Intergenic
950775412 3:15345714-15345736 TTCTAAGCAGAGAGAGCAGCTGG + Intergenic
950808279 3:15627217-15627239 TTCTCAGAAGCTACGGCACCAGG + Intronic
951689333 3:25379282-25379304 TTCTCAGGAGCTAGAGTAGGAGG + Intronic
954386498 3:50246633-50246655 TTCTCAGAAGCAGCAGCGGCTGG - Intronic
955727996 3:61953115-61953137 TTCTGAGTAGAGACAGCAGTAGG - Intronic
959469320 3:106730190-106730212 CTCTCAGGGGAGACAGCAGTTGG - Intergenic
959611484 3:108300042-108300064 ATCTGAGGAGGGAAAGCAGCAGG + Intronic
960042168 3:113161779-113161801 TTTTCAGAAGCGACAGCCTCTGG + Intergenic
963236590 3:142963039-142963061 TGCTCAGGAACAGCAGCAGCGGG + Exonic
964644766 3:158947337-158947359 GGCTCAGGAGCCACAGCAGCAGG - Intergenic
964850087 3:161086667-161086689 AACTCAGGAGTGACAGCAGCAGG + Exonic
968344029 3:197984977-197984999 TTATCAGAAGCGGCAGCAGAAGG - Intronic
973241605 4:47961766-47961788 TGCTCAGTAGCTACAACAGCTGG - Intronic
978380859 4:108127079-108127101 TTCTCAGGAGACATAGGAGCTGG + Intronic
980909137 4:138978108-138978130 TTCGAAGGACCCACAGCAGCAGG - Intergenic
981110558 4:140929047-140929069 TTCCCAGGAGCAACACCAGTTGG - Intronic
990507861 5:56462556-56462578 TTCTCATGAGCATCAGCAGTCGG + Intronic
992834515 5:80627001-80627023 TACTCAGGAGGCTCAGCAGCAGG - Exonic
998411421 5:141914327-141914349 TTCACAGCCGCGGCAGCAGCAGG + Intergenic
1003568750 6:7242101-7242123 TCCACAGTAGCGAAAGCAGCCGG + Intronic
1003996120 6:11541156-11541178 TTCTTAGGAGCTAATGCAGCTGG - Intronic
1004258349 6:14085515-14085537 TTCTGAGGATCTACAGCTGCTGG + Intergenic
1004770356 6:18774294-18774316 TTCTCAGGTGCTACAAAAGCTGG - Intergenic
1005916911 6:30360339-30360361 TTGGAAGGAGCGACAGCAGATGG - Intergenic
1011206230 6:84902310-84902332 TTCTCAGGTGGGGCAACAGCAGG + Intergenic
1018612935 6:165661787-165661809 TTCTCTGGAGGGGCAGGAGCCGG - Intronic
1019594522 7:1852250-1852272 TTCTCAGGGATGACGGCAGCTGG + Intronic
1020765006 7:12308246-12308268 TTCTTAGGAGCTAATGCAGCTGG - Intergenic
1022412222 7:30148258-30148280 TTTTCAGTAGAGAGAGCAGCAGG + Intronic
1022465010 7:30647802-30647824 TTCACATGAGTGACAGCAGATGG - Intergenic
1022770869 7:33471570-33471592 TTCTCATTAGTGACAGAAGCAGG + Intronic
1022771360 7:33476385-33476407 TTCTCAGGATCCACGTCAGCTGG + Intronic
1023386558 7:39663662-39663684 TTCACTGCAGCTACAGCAGCAGG + Intronic
1025187583 7:56873281-56873303 TGCTCAGGATGGAGAGCAGCAGG + Intergenic
1025684341 7:63703645-63703667 TGCTCAGGATGGAGAGCAGCAGG - Intergenic
1026820129 7:73541778-73541800 TTCTTAGGAGAGGCAGGAGCTGG + Intronic
1027122754 7:75533737-75533759 TTGTCAGGAGCCAAAGCAACAGG - Exonic
1029986430 7:104927314-104927336 TTCTCAGCAGCAATACCAGCTGG - Intergenic
1034963343 7:155375570-155375592 TTCTCTGGAGCTCCAGCTGCAGG - Intergenic
1035650925 8:1264236-1264258 ATCTCAGGAGCGACTGCAGCTGG - Intergenic
1037638475 8:20721585-20721607 TTCTGATGAGGGGCAGCAGCAGG - Intergenic
1037839149 8:22231750-22231772 TACTCAGGATCAACAGCAGCAGG + Intronic
1038245269 8:25849171-25849193 TTCTCACTAGAGAAAGCAGCGGG - Intronic
1038962571 8:32537587-32537609 TTGGCAGGAGCAGCAGCAGCTGG + Intronic
1039787379 8:40846049-40846071 GTATTAGGAGAGACAGCAGCTGG + Intronic
1040456068 8:47599127-47599149 TTCCCAGCAGAGACAGCACCAGG + Exonic
1043271556 8:78340160-78340182 CTCTCAGGATAGACAGTAGCAGG - Intergenic
1045503151 8:102758590-102758612 TTCTCAGGTGAGAGACCAGCTGG + Intergenic
1047381889 8:124372130-124372152 TCCTCAGCAGCGGCAGCAGCCGG + Exonic
1048769667 8:137882355-137882377 TTCTCAGGAGAAACACAAGCTGG + Intergenic
1049398324 8:142412235-142412257 TGCTCAGTGGCGACAGCAGGAGG + Intergenic
1049808501 8:144552315-144552337 TTCTCAGGAGCGACAGCAGCAGG - Intronic
1050761578 9:9078665-9078687 TTCTCAGGAGATACAGCTGCAGG + Intronic
1053198325 9:36136628-36136650 TTATAAGGAGCGACAGCTGAGGG - Intronic
1055575638 9:77658043-77658065 TGTCCAGGAGCGACAACAGCCGG + Intergenic
1056381837 9:86063047-86063069 TGTTCAGGAGTGAGAGCAGCGGG - Intronic
1057181212 9:93031633-93031655 GTCTCAGGAGCCACAGCAGAGGG - Intronic
1058711580 9:107683722-107683744 TTCTCAGCAGAGAAAGCAGCTGG - Intergenic
1058745725 9:107988865-107988887 TTCCCATGAGCAACATCAGCAGG + Intergenic
1062317902 9:135977562-135977584 TTCTGAGAAGGGCCAGCAGCCGG - Intergenic
1062478168 9:136739791-136739813 TTCTCAGGGGCGGCAGGAGGTGG + Intronic
1062638909 9:137506770-137506792 TCCTCAGAATCCACAGCAGCTGG - Intronic
1186235744 X:7507592-7507614 TTTTCAGGAGAGACAACAACTGG + Intergenic
1193012684 X:76695333-76695355 TTGTTAGGAGCTAAAGCAGCTGG + Intergenic
1197037642 X:121895762-121895784 GTCTCAGGGGTGGCAGCAGCAGG - Intergenic
1198428820 X:136545924-136545946 GTCTCAGGACCAACAGCATCAGG + Intronic