ID: 1049808503

View in Genome Browser
Species Human (GRCh38)
Location 8:144552330-144552352
Sequence AGGGACAGCAGCCGCTTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 201}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049808503_1049808509 -1 Left 1049808503 8:144552330-144552352 CCTGAGAAGCGGCTGCTGTCCCT 0: 1
1: 0
2: 2
3: 19
4: 201
Right 1049808509 8:144552352-144552374 TGCAGAGCCTGGACGGAGCTGGG No data
1049808503_1049808511 11 Left 1049808503 8:144552330-144552352 CCTGAGAAGCGGCTGCTGTCCCT 0: 1
1: 0
2: 2
3: 19
4: 201
Right 1049808511 8:144552364-144552386 ACGGAGCTGGGAGAAGCGCGCGG No data
1049808503_1049808513 28 Left 1049808503 8:144552330-144552352 CCTGAGAAGCGGCTGCTGTCCCT 0: 1
1: 0
2: 2
3: 19
4: 201
Right 1049808513 8:144552381-144552403 GCGCGGCGGCAGCAGCCGACAGG No data
1049808503_1049808508 -2 Left 1049808503 8:144552330-144552352 CCTGAGAAGCGGCTGCTGTCCCT 0: 1
1: 0
2: 2
3: 19
4: 201
Right 1049808508 8:144552351-144552373 CTGCAGAGCCTGGACGGAGCTGG No data
1049808503_1049808505 -8 Left 1049808503 8:144552330-144552352 CCTGAGAAGCGGCTGCTGTCCCT 0: 1
1: 0
2: 2
3: 19
4: 201
Right 1049808505 8:144552345-144552367 CTGTCCCTGCAGAGCCTGGACGG No data
1049808503_1049808512 14 Left 1049808503 8:144552330-144552352 CCTGAGAAGCGGCTGCTGTCCCT 0: 1
1: 0
2: 2
3: 19
4: 201
Right 1049808512 8:144552367-144552389 GAGCTGGGAGAAGCGCGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049808503 Original CRISPR AGGGACAGCAGCCGCTTCTC AGG (reversed) Intronic
900126655 1:1071796-1071818 AGGGCCAGCAGCCTCTGCCCAGG - Exonic
901226690 1:7617159-7617181 AGCCACAGCAGCCGCTTGGCTGG - Intronic
901279932 1:8026159-8026181 CGGGGCAGCCGCCGCTCCTCCGG - Exonic
901982606 1:13048544-13048566 ACGGACAGCACCTTCTTCTCAGG - Intronic
902602000 1:17546320-17546342 AAGGACAGAAGCAGCTTTTCTGG - Intronic
902615082 1:17619280-17619302 AGGGACAGCACACCCTGCTCAGG - Intronic
902817690 1:18925603-18925625 AGGCACAGGAGCCGGGTCTCAGG + Intronic
903302489 1:22389433-22389455 TGGGGCTGGAGCCGCTTCTCTGG + Intergenic
903978872 1:27170845-27170867 AGGGACAGGACCAGCTTCACTGG + Intergenic
904026250 1:27505368-27505390 AGGGACAAAGGCCTCTTCTCAGG + Intergenic
907796337 1:57721670-57721692 AGGGGCAGCAGGAGCTTCTTAGG + Intronic
908845364 1:68319046-68319068 ATGGACAGCAGGCACTTCTCTGG - Intergenic
911413456 1:97540493-97540515 AGGGACAGAAGCTTCTGCTCTGG - Intronic
915367340 1:155323563-155323585 ACGGGCAGCAGCTGCTCCTCTGG - Intronic
917422309 1:174877455-174877477 TGGGACAGCAGCTGCTGCTGTGG + Intronic
917925512 1:179786304-179786326 AGTGACAGCAGCAGGGTCTCAGG + Intronic
918316582 1:183327839-183327861 AGGGAAAGCAGTAGCTTCCCAGG - Intronic
920399796 1:205669721-205669743 GGGGAGAGGAGCCGCTTCTGAGG - Intronic
920998405 1:211017230-211017252 TGGGACAGCAGCCTTTTCTCTGG - Intronic
922205496 1:223442908-223442930 GGCAACAGCAGCCACTTCTCTGG + Intergenic
922658681 1:227409563-227409585 AGTGACACCACCCGCTTCCCTGG - Intergenic
924383946 1:243486321-243486343 AGGGAGAGCTGCCCCTTCTTAGG + Intronic
1063121745 10:3109522-3109544 TGGGACAGAAGCTGCTTGTCAGG + Intronic
1063964979 10:11339764-11339786 AGGGAGCGGATCCGCTTCTCAGG - Intergenic
1064273964 10:13890375-13890397 AGGGTCAGCAGTGGCTTCCCAGG + Intronic
1065811780 10:29449554-29449576 GGGCACAGCAGGTGCTTCTCGGG + Intergenic
1067199600 10:44155904-44155926 AGTGACAGCATCAGATTCTCAGG - Intergenic
1072422840 10:95303937-95303959 AGGGAAAGCAGCAGCTTTTGGGG + Intergenic
1073201139 10:101736871-101736893 AGGAACAGCTGCCTCCTCTCAGG + Intergenic
1073774524 10:106770973-106770995 AGGGGCAGCAGGCCCTTCTCTGG + Intronic
1076547099 10:131252756-131252778 AGGAGCAGCAGCTGCTTCCCGGG - Intronic
1076748681 10:132528534-132528556 AAGGTCTGCAGCTGCTTCTCTGG - Intergenic
1076884431 10:133255301-133255323 AGGGACTGCAGCCGCTCAGCGGG - Intergenic
1077299207 11:1839425-1839447 GGGGACAGCTGCAGCTCCTCAGG + Intronic
1077359393 11:2134024-2134046 AGGGACAGCAGTCCCTCCTGTGG - Intronic
1078895742 11:15595374-15595396 AGGCACAGCAACAGCTTCACTGG + Intergenic
1079263273 11:18904898-18904920 ATGGAATGCAGCCCCTTCTCTGG - Intergenic
1079265534 11:18928626-18928648 ATGGAATGCAGCCCCTTCTCTGG - Intergenic
1079690037 11:23406353-23406375 AGGGGCAGCAGCCAGGTCTCGGG + Intergenic
1080578514 11:33622370-33622392 AGAGGCAGCAGCCCCTCCTCAGG - Intronic
1083319136 11:61834696-61834718 AGCCACTGCAGCTGCTTCTCAGG + Intronic
1083755485 11:64789664-64789686 TGGTACATCAGCCCCTTCTCTGG + Intronic
1084423663 11:69072760-69072782 TGGGCCAGCAGCCCCTTTTCAGG + Intronic
1091710795 12:2738593-2738615 TGGGACAGCAGCCTCCTCACAGG + Intergenic
1092084294 12:5742975-5742997 AGGGAGAGCAGCTGCGTCCCGGG - Intronic
1096541689 12:52311447-52311469 AGAGCCAGCTGCCTCTTCTCCGG - Intergenic
1098848840 12:75570240-75570262 AGAGACAGCTGACCCTTCTCAGG + Intergenic
1100195949 12:92244707-92244729 AGGTACAGCTGCCACTTCTGGGG + Intergenic
1101084277 12:101219665-101219687 AGGGCCAGCAACCACTTTTCTGG - Intergenic
1102310759 12:111842601-111842623 ACGGGCAGCAGCCGCCCCTCGGG - Intronic
1102673913 12:114643547-114643569 GGGGCCAGCAGCTGCTTCTGGGG - Intergenic
1103600501 12:122051510-122051532 CAGGGCAGCAGCCGATTCTCTGG - Intronic
1104809118 12:131609962-131609984 AGCGTCACCAGCCGCTTCCCTGG - Intergenic
1105261442 13:18782633-18782655 AGGGACTGTAGCCTTTTCTCAGG - Intergenic
1107712955 13:43168780-43168802 ACGGTCAGCAGCCTCTTATCAGG + Intergenic
1110166607 13:72449911-72449933 GGGAACCACAGCCGCTTCTCAGG - Intergenic
1113671146 13:112176482-112176504 TGGGACAGCAGCAGCACCTCGGG + Intergenic
1113802913 13:113095777-113095799 AGGAACAGCTGCCGCTTCCTGGG + Intronic
1114047124 14:18885068-18885090 AAGGACAGCTGACTCTTCTCAGG - Intergenic
1117097800 14:52315235-52315257 AAGGTCCGCAGCGGCTTCTCCGG - Exonic
1122139144 14:99651976-99651998 AGCAACAGCAGCAGCTACTCTGG - Intronic
1122762661 14:104041128-104041150 AGAGACAGCTGCCGATGCTCCGG + Intronic
1122898420 14:104771891-104771913 AGGGACAGCACCTACTTTTCTGG - Intronic
1123220342 14:106849787-106849809 AGGGCAAGCAGCAGCCTCTCTGG + Intergenic
1202834652 14_GL000009v2_random:68807-68829 AGGGACTGTAGCCTTTTCTCAGG + Intergenic
1123968389 15:25481182-25481204 TAGGGCAGCAGCCTCTTCTCTGG - Intergenic
1126376947 15:48006324-48006346 AGTTACATCAGCCGCTTCTTGGG + Intergenic
1127875983 15:63111682-63111704 AGGGACAGCTGCCACATCTGAGG + Intergenic
1128581991 15:68817444-68817466 AAGGACAGCAGCCTGTTCCCCGG - Intronic
1133234693 16:4382387-4382409 AGCGTCACCAGCCGCTTATCAGG - Exonic
1134138700 16:11697921-11697943 AGGGACTGCCGCAGCCTCTCTGG - Intronic
1134442900 16:14309852-14309874 AGGGGCAGCACCCCCTGCTCTGG + Intergenic
1137249761 16:46732903-46732925 TGGGACAGAAGCAGGTTCTCAGG - Intronic
1137798608 16:51242405-51242427 TAGGACAGCAGCCACATCTCAGG + Intergenic
1138208086 16:55139673-55139695 GGGGAAGGCAGCCACTTCTCAGG - Intergenic
1138803230 16:60060580-60060602 AAGGACAGCGGCTTCTTCTCAGG + Intergenic
1141577167 16:84971439-84971461 AAGGACAGCAGGCACTACTCGGG + Intergenic
1142753764 17:2003469-2003491 AGGAACAGCAGCAGCGGCTCCGG + Intronic
1142847959 17:2691163-2691185 AGGGAATGAAGCCGCTTCTTAGG + Intronic
1143014219 17:3883112-3883134 AGGGGCAGCAGCTGCTTGGCTGG + Exonic
1145242816 17:21249568-21249590 AGGGGCAGCAGCTGACTCTCTGG + Intronic
1147340618 17:39751441-39751463 AGGGGAAGCAGGGGCTTCTCTGG + Intergenic
1148134437 17:45283240-45283262 AGGGACAGCTGAGCCTTCTCCGG + Intronic
1148262215 17:46193473-46193495 AGGGACAGCAGCGCCTCCGCCGG + Intronic
1149639515 17:58193728-58193750 TGGGACAGCAGCCGCAGCTGTGG - Exonic
1150465158 17:65386447-65386469 AAGGACAGCAGCCACTACTGAGG + Intergenic
1151978642 17:77496647-77496669 CGGGACAGTGGCCACTTCTCAGG - Intronic
1152873530 17:82772477-82772499 AAGGACAGCAGCTGCATCTCGGG - Exonic
1153917383 18:9758122-9758144 ATGAACAGGAGCCGCGTCTCGGG - Intronic
1156694754 18:39753306-39753328 AGGGACAGCTGCCATTTCTGCGG + Intergenic
1157478046 18:48035925-48035947 AGGGACAGGAGCTGCCTCTGTGG + Intronic
1157762290 18:50273847-50273869 CTGGGCAGCAGCCGCTTCTATGG + Exonic
1158023601 18:52870389-52870411 AGCGATGGCAGCCGCTGCTCTGG + Intronic
1158399992 18:57113441-57113463 AGGGACACCAGGCCCTCCTCTGG - Intergenic
1158426621 18:57346288-57346310 AGCAACAGCAGCTGCTTCTTGGG + Intergenic
1158491736 18:57916310-57916332 AGTGACTGCAGCCCCTCCTCTGG - Intergenic
1158735573 18:60075375-60075397 AGGCACAGCAGCCCCATTTCTGG - Intergenic
1160157668 18:76445941-76445963 TGGCACAGAGGCCGCTTCTCTGG - Intronic
1160250802 18:77202105-77202127 AGGGTCCCCAGCAGCTTCTCTGG + Intergenic
1164934192 19:32198395-32198417 AGAGACAGCCGTGGCTTCTCTGG - Intergenic
1166052085 19:40266308-40266330 AGAGCCAGCTGCCACTTCTCTGG - Intronic
1166055028 19:40283571-40283593 AGGGACTGCAGCCAGTCCTCTGG + Intronic
1166741969 19:45119898-45119920 AGGGACCCCAGGCCCTTCTCCGG - Intronic
1167522075 19:49961029-49961051 AGGGGCAGCAGCAGCATCTCTGG + Exonic
1167523307 19:49969696-49969718 AGGGGCAGCAGCAGCATCTCTGG - Intergenic
1167774541 19:51546034-51546056 GGGGACAGCAGCCCCCACTCAGG - Intergenic
1168148234 19:54431093-54431115 AAGGACAGCAGAGGCTTCTGCGG - Exonic
1202638048 1_KI270706v1_random:58887-58909 AGGGACTGTAGCCTTTTCTCAGG - Intergenic
925480921 2:4272954-4272976 ATGGCCAGCAGCCGCATCCCAGG - Intergenic
928193199 2:29193290-29193312 AGGGGCAGTAGCGGCTTCTAAGG + Exonic
931587006 2:63840603-63840625 AGGGAGCCCAGACGCTTCTCAGG - Intergenic
936396970 2:112138569-112138591 AGGGACGGCTGCCGCATCGCTGG + Exonic
937127974 2:119486310-119486332 AGGCCGAGCAGCCACTTCTCTGG + Intronic
937463651 2:122110602-122110624 AGGGTCAGCAGATGCTTCTTCGG + Intergenic
937937587 2:127258562-127258584 AGGGAGGGCAGCCCCTTCCCAGG + Intronic
938625998 2:133110375-133110397 TGAGACAGCAGCATCTTCTCAGG - Intronic
941599440 2:167523065-167523087 TGGGACAGCAGATGCTTTTCTGG - Intergenic
941649197 2:168075114-168075136 AGGGAAAGCAGCTTTTTCTCAGG - Exonic
943980210 2:194539796-194539818 AGTGGCAGCAGCCACTGCTCAGG - Intergenic
948405078 2:237711456-237711478 AGGGACACCACCCCCTCCTCCGG - Intronic
948807683 2:240460018-240460040 AGGGACGGCAGCTGCTGCTGGGG + Intronic
1169913644 20:10667120-10667142 AGGGGAGGCAGCCGCTTCTCAGG - Intronic
1172093449 20:32449160-32449182 AGGCAGAGCTGCCGCTTCCCTGG + Intronic
1174847133 20:53953454-53953476 AGGGACTGCTGCCGCTTCTCAGG + Exonic
1175895087 20:62332575-62332597 AGGGAGAGCAGCCCCTGCTGGGG + Exonic
1176847504 21:13887914-13887936 AGGGACTGTAGCCTTTTCTCAGG - Intergenic
1178919115 21:36726953-36726975 TGGGACTGCAGCCGGTTCTAGGG - Intronic
1180107027 21:45625844-45625866 AGGGACAGCAGCCTCCTATATGG - Intergenic
1180195078 21:46189266-46189288 AGGGACAGCAGCCTCTGCTCAGG + Exonic
1180363920 22:11922993-11923015 AGGGACTGTAGCCTTTTCTCAGG + Intergenic
1180465657 22:15607719-15607741 AAGGACAGCTGACTCTTCTCAGG - Intergenic
1181463455 22:23098486-23098508 AGGGACAGCAGCCACTGGCCTGG + Intronic
1181519708 22:23438193-23438215 AGGGACTGCAGCCCCTGCACGGG + Intergenic
1182356552 22:29724783-29724805 AGGCCCAGCAGCCTTTTCTCAGG - Intronic
1182510498 22:30816605-30816627 AGAGACAGAGGCCGCCTCTCTGG - Intronic
1183310753 22:37108346-37108368 AGGGGCAGCCGCCCCTTCTAGGG - Intronic
1183326540 22:37197647-37197669 AGGGACAGGAGGCTCTTCTCCGG - Intronic
1183464554 22:37973173-37973195 AGGGTGAGCAGGCCCTTCTCAGG + Exonic
1184765266 22:46569038-46569060 AGGGACAGCAGGGGCTCCCCGGG + Intergenic
1185131654 22:49042943-49042965 ACGCACAGCACCCGCTTCTATGG - Intergenic
952452035 3:33441293-33441315 AGCGCCAGCAGCCGCTCCTAAGG - Intronic
953574266 3:44100399-44100421 AGGGACAGCAACCCCTTCAGAGG - Intergenic
954864011 3:53713662-53713684 AGGGAAATCTGCTGCTTCTCAGG - Intronic
957613076 3:82494143-82494165 AGCGACAGGAGCCTCATCTCTGG + Intergenic
961442269 3:126960100-126960122 TGTGACAGCAACCGCTTCCCAGG - Intronic
963202828 3:142602171-142602193 AGGGACAGCAGCTTTTTCTCTGG + Intronic
965099361 3:164277112-164277134 AGCGTCAGCATCTGCTTCTCAGG + Intergenic
966154847 3:176904454-176904476 AGTGAAAGAAGCCTCTTCTCAGG - Intergenic
968713703 4:2139099-2139121 AGGGAGAGGAGCCCCTCCTCTGG + Intronic
969505319 4:7583116-7583138 TGGGACAGCAGCCACCTCTGTGG + Intronic
969998788 4:11343051-11343073 TGGGACATCAGCCCCTTCTCAGG + Intergenic
972532957 4:39977277-39977299 AGGGACCCCAGCTGCTTCTCTGG + Intronic
973368267 4:49225234-49225256 AGGGACTGTAGCCTTTTCTCAGG - Intergenic
973392778 4:49570191-49570213 AGGGACTGTAGCCTTTTCTCAGG + Intergenic
974283503 4:59831946-59831968 AGCAACAGTAGCGGCTTCTCTGG + Intergenic
976224218 4:82782437-82782459 AGGGGCAGCAGCTGCTTCCCAGG - Intronic
976824684 4:89248145-89248167 TGTGACAGCAGCTGCTGCTCAGG - Exonic
976828660 4:89288124-89288146 AGGGACATCTGCCACTGCTCTGG - Intronic
979788969 4:124754262-124754284 AGGGGCAGCAGCTCCTTATCTGG - Intergenic
982991863 4:162286447-162286469 ATGGACACCAGCATCTTCTCTGG - Intergenic
984256628 4:177397492-177397514 AGGGACAGCATCCAACTCTCTGG - Intergenic
1202765371 4_GL000008v2_random:144744-144766 AGGGACTGTAGCCTTTTCTCAGG - Intergenic
986770087 5:10964934-10964956 AGGGACAGCTGTGGCTCCTCAGG - Intergenic
987066077 5:14291008-14291030 AGGGACAGAAGCTGCTTCAGAGG + Exonic
988298446 5:29393410-29393432 AGGGACAGCCCTCACTTCTCTGG + Intergenic
988404691 5:30809182-30809204 ATGGACAGCAGCAGCAGCTCAGG - Intergenic
988712140 5:33789246-33789268 TGGGACAGCAGCTGGTTCTCTGG - Intronic
993125710 5:83833388-83833410 AGTGCCAGCAGCTGCTTCTGGGG - Intergenic
997287126 5:132688106-132688128 AGGGGCAGAAGAGGCTTCTCAGG - Intergenic
1000027055 5:157368458-157368480 AGGGACAGGACACGCTTCTTGGG - Intronic
1003062673 6:2875433-2875455 GGGGACAGGAGCCGCTGCCCTGG - Intergenic
1005867076 6:29944430-29944452 AGGGAAAGCAGGAGCCTCTCTGG + Intronic
1006113618 6:31763521-31763543 AGCGACAGCAGCTGCATCTAGGG + Exonic
1006412332 6:33881555-33881577 AGGGACAGCAGCCTCAAGTCTGG - Intergenic
1006716935 6:36126414-36126436 AACAACAGCAGCCACTTCTCAGG + Intergenic
1007075962 6:39066203-39066225 AGGAACAGGAGCTGCTCCTCCGG - Exonic
1007481303 6:42151973-42151995 AGGGAGACAAGCTGCTTCTCGGG - Intergenic
1007548021 6:42708821-42708843 AGTGATAGCAGCTGCCTCTCAGG + Intronic
1012032347 6:94087825-94087847 AGGGGCAGAAGCCTCTTTTCTGG + Intergenic
1016648193 6:146434383-146434405 AGGGACCGCAGCCCGTTCCCGGG - Exonic
1017690213 6:156956481-156956503 AGGGACAGCAGCCCTTTCTGTGG + Intronic
1017884795 6:158590058-158590080 AGACACAGCACCCCCTTCTCTGG + Intronic
1018718488 6:166554232-166554254 AGGGGTAGCAGTCGCTTCTCAGG - Intronic
1019341904 7:512371-512393 ATGGGCAGGGGCCGCTTCTCGGG + Exonic
1019591554 7:1838080-1838102 AGGGACTGCAGCCCCTGCACGGG - Intronic
1022391786 7:29950085-29950107 AGGCACAGCTGCAGCTGCTCTGG + Intronic
1023653919 7:42400978-42401000 AGGAGCAGCAGCCTCCTCTCCGG + Intergenic
1024342377 7:48280544-48280566 AGGGACAGCTGCAGCATCTCTGG - Intronic
1025237487 7:57244704-57244726 ATGGACAGGAGACACTTCTCAGG + Intergenic
1031043260 7:116861272-116861294 AGGGACAACCTCCGCCTCTCGGG + Intronic
1032907474 7:136387073-136387095 AAGCACAGCAGCTGCCTCTCAGG + Intergenic
1035024029 7:155814995-155815017 GGGCAGAGCAGCAGCTTCTCTGG - Intergenic
1035244425 7:157553032-157553054 GAGGACAGCAGCGGCTTCTACGG + Intronic
1037632923 8:20674570-20674592 AGGTGCAGCAACAGCTTCTCAGG - Intergenic
1037646410 8:20796426-20796448 AGGATAAGCAGCCACTTCTCAGG + Intergenic
1041244938 8:55880433-55880455 AGGGACAGCAGCCGGCCCTCGGG - Intronic
1049268140 8:141680516-141680538 AGAGACAGCAGCTGCATCCCGGG - Intergenic
1049808503 8:144552330-144552352 AGGGACAGCAGCCGCTTCTCAGG - Intronic
1049808801 8:144553963-144553985 AGGGCCAGCAGCTGCACCTCTGG - Intronic
1053663604 9:40301693-40301715 AGGGACTGTAGCCTTTTCTCAGG + Intronic
1053665475 9:40314593-40314615 AGGGACAGTAGCCTTGTCTCAGG + Intronic
1053914119 9:42932235-42932257 AGGGACTGTAGCCTTTTCTCAGG + Intergenic
1053915065 9:42939640-42939662 AGGGACAGTAGCCTTGTCTCAGG + Intergenic
1054375728 9:64447926-64447948 AGGGACTGTAGCCTTTTCTCAGG + Intergenic
1054376630 9:64454623-64454645 AGGGACAGTAGCCTTGTCTCAGG + Intergenic
1054519139 9:66061691-66061713 AGGGACAGTAGCCTTGTCTCAGG - Intergenic
1054521011 9:66074592-66074614 AGGGACTGTAGCCTTTTCTCAGG - Intergenic
1055139206 9:72856343-72856365 AGGCACAGCAGGCACTTCTCAGG + Intergenic
1057298932 9:93865442-93865464 AGTGGCAGCTGCCGCCTCTCAGG + Intergenic
1059459351 9:114420053-114420075 AGCCACAGCAGCCGCTCCTGGGG + Intronic
1060699697 9:125740031-125740053 AGGGAAAGCAGTTGCTTCTTTGG + Intergenic
1061183351 9:129037645-129037667 GGGGACAGCAGGGGCTGCTCTGG + Intronic
1062046253 9:134425793-134425815 GGGGACAGCAGCCGTGACTCTGG + Intronic
1062461607 9:136664732-136664754 AGGGGCAGGAGCTGCTCCTCCGG - Exonic
1062590441 9:137272281-137272303 GGGGACAGCAGCCACCTCTCAGG - Intronic
1203546119 Un_KI270743v1:129633-129655 AGGGACTGTAGCCTTTTCTCAGG - Intergenic
1185485654 X:479683-479705 AGAGACGGCACCAGCTTCTCCGG - Intergenic
1187570214 X:20493222-20493244 AGAGACACCAGCTGGTTCTCTGG - Intergenic
1191775349 X:64807785-64807807 AGGGACAGCAGCCAACTCTGAGG + Intergenic
1196746345 X:119074052-119074074 AGGGGCAGCAGCCTCCTCTGTGG - Intergenic
1197257095 X:124275074-124275096 AGGGACAGCCCACGCATCTCTGG - Intronic
1197800702 X:130344879-130344901 ATGGACTGAAGCCTCTTCTCTGG + Intronic
1201010842 Y:9547359-9547381 AGGCACCGCAGCCGCTGCTGCGG + Intergenic