ID: 1049808505

View in Genome Browser
Species Human (GRCh38)
Location 8:144552345-144552367
Sequence CTGTCCCTGCAGAGCCTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049808501_1049808505 7 Left 1049808501 8:144552315-144552337 CCTGCTGCTGTCGCTCCTGAGAA 0: 1
1: 0
2: 2
3: 14
4: 178
Right 1049808505 8:144552345-144552367 CTGTCCCTGCAGAGCCTGGACGG No data
1049808499_1049808505 20 Left 1049808499 8:144552302-144552324 CCAGAAGCGCGTCCCTGCTGCTG 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1049808505 8:144552345-144552367 CTGTCCCTGCAGAGCCTGGACGG No data
1049808503_1049808505 -8 Left 1049808503 8:144552330-144552352 CCTGAGAAGCGGCTGCTGTCCCT 0: 1
1: 0
2: 2
3: 19
4: 201
Right 1049808505 8:144552345-144552367 CTGTCCCTGCAGAGCCTGGACGG No data
1049808500_1049808505 8 Left 1049808500 8:144552314-144552336 CCCTGCTGCTGTCGCTCCTGAGA 0: 1
1: 0
2: 0
3: 16
4: 178
Right 1049808505 8:144552345-144552367 CTGTCCCTGCAGAGCCTGGACGG No data
1049808498_1049808505 26 Left 1049808498 8:144552296-144552318 CCACAGCCAGAAGCGCGTCCCTG 0: 1
1: 0
2: 1
3: 12
4: 133
Right 1049808505 8:144552345-144552367 CTGTCCCTGCAGAGCCTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049808505 Original CRISPR CTGTCCCTGCAGAGCCTGGA CGG Intronic
No off target data available for this crispr