ID: 1049810071

View in Genome Browser
Species Human (GRCh38)
Location 8:144562739-144562761
Sequence CGCACCCCAGTGGTTTCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049810063_1049810071 25 Left 1049810063 8:144562691-144562713 CCATCGGACTCCAGTGGTTTCCA 0: 6
1: 14
2: 32
3: 16
4: 123
Right 1049810071 8:144562739-144562761 CGCACCCCAGTGGTTTCCATTGG No data
1049810067_1049810071 5 Left 1049810067 8:144562711-144562733 CCATCGGACTCACTCCAGTGGTT 0: 6
1: 7
2: 6
3: 25
4: 102
Right 1049810071 8:144562739-144562761 CGCACCCCAGTGGTTTCCATTGG No data
1049810068_1049810071 -9 Left 1049810068 8:144562725-144562747 CCAGTGGTTTCCATCGCACCCCA 0: 2
1: 11
2: 36
3: 27
4: 136
Right 1049810071 8:144562739-144562761 CGCACCCCAGTGGTTTCCATTGG No data
1049810065_1049810071 15 Left 1049810065 8:144562701-144562723 CCAGTGGTTTCCATCGGACTCAC 0: 7
1: 8
2: 9
3: 23
4: 101
Right 1049810071 8:144562739-144562761 CGCACCCCAGTGGTTTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049810071 Original CRISPR CGCACCCCAGTGGTTTCCAT TGG Intronic
No off target data available for this crispr