ID: 1049812629

View in Genome Browser
Species Human (GRCh38)
Location 8:144582294-144582316
Sequence CACCCTTTGAAACCAGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049812612_1049812629 30 Left 1049812612 8:144582241-144582263 CCCCCTGGCGGCCGGCGCAGACT 0: 1
1: 0
2: 1
3: 8
4: 67
Right 1049812629 8:144582294-144582316 CACCCTTTGAAACCAGGCCAGGG No data
1049812614_1049812629 28 Left 1049812614 8:144582243-144582265 CCCTGGCGGCCGGCGCAGACTGG 0: 1
1: 0
2: 0
3: 12
4: 95
Right 1049812629 8:144582294-144582316 CACCCTTTGAAACCAGGCCAGGG No data
1049812620_1049812629 19 Left 1049812620 8:144582252-144582274 CCGGCGCAGACTGGCTGCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 162
Right 1049812629 8:144582294-144582316 CACCCTTTGAAACCAGGCCAGGG No data
1049812622_1049812629 -7 Left 1049812622 8:144582278-144582300 CCTTCATCCCACGTCCCACCCTT 0: 1
1: 0
2: 8
3: 88
4: 730
Right 1049812629 8:144582294-144582316 CACCCTTTGAAACCAGGCCAGGG No data
1049812616_1049812629 27 Left 1049812616 8:144582244-144582266 CCTGGCGGCCGGCGCAGACTGGC 0: 1
1: 0
2: 0
3: 12
4: 140
Right 1049812629 8:144582294-144582316 CACCCTTTGAAACCAGGCCAGGG No data
1049812613_1049812629 29 Left 1049812613 8:144582242-144582264 CCCCTGGCGGCCGGCGCAGACTG 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1049812629 8:144582294-144582316 CACCCTTTGAAACCAGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049812629 Original CRISPR CACCCTTTGAAACCAGGCCA GGG Intronic
No off target data available for this crispr