ID: 1049814744

View in Genome Browser
Species Human (GRCh38)
Location 8:144592929-144592951
Sequence ATGCTGACCCTCTGTGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049814744_1049814748 11 Left 1049814744 8:144592929-144592951 CCTCCACCACAGAGGGTCAGCAT 0: 1
1: 0
2: 2
3: 11
4: 193
Right 1049814748 8:144592963-144592985 TGCAATCTGAGGTGTGTTTGAGG No data
1049814744_1049814747 0 Left 1049814744 8:144592929-144592951 CCTCCACCACAGAGGGTCAGCAT 0: 1
1: 0
2: 2
3: 11
4: 193
Right 1049814747 8:144592952-144592974 CAACTCACAGATGCAATCTGAGG No data
1049814744_1049814749 24 Left 1049814744 8:144592929-144592951 CCTCCACCACAGAGGGTCAGCAT 0: 1
1: 0
2: 2
3: 11
4: 193
Right 1049814749 8:144592976-144592998 GTGTTTGAGGAATATTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049814744 Original CRISPR ATGCTGACCCTCTGTGGTGG AGG (reversed) Intronic
900650778 1:3729188-3729210 ATCCTGAGCCTCTGGGGTGCTGG + Intronic
900794589 1:4700428-4700450 ATGAGGATCCTCTGGGGTGGGGG - Intronic
901071183 1:6519510-6519532 ATGCTTGACCTCTGCGGTGGTGG + Intronic
902098789 1:13967895-13967917 TTGCTGCCCATCTGTGTTGGAGG - Intergenic
902123348 1:14186876-14186898 ATCCTGAACCCCTCTGGTGGGGG - Intergenic
903059359 1:20658938-20658960 TTGCTGACCCTCGGTGGTCAAGG - Intronic
905127463 1:35725652-35725674 AGGCTGGCCCTTTGTGCTGGGGG - Intronic
905529128 1:38662487-38662509 ATGCAGCCTTTCTGTGGTGGTGG - Intergenic
905532666 1:38694505-38694527 ATTCTGCCCCTCTGTTGGGGAGG - Intergenic
906201127 1:43961038-43961060 ATCCTGACCCTGGGTGGGGGTGG + Intronic
907476764 1:54711015-54711037 ATGCTGACCTGCTGTGCTGTTGG - Intronic
907953212 1:59203946-59203968 ATGCACACCCTCTCTGGTGGTGG - Intergenic
908867435 1:68566122-68566144 ATGCAGACCCACTGTGGATGCGG - Intergenic
913979107 1:143492518-143492540 ATGCTGACCGCCTGTGATGCTGG - Intergenic
914073512 1:144318168-144318190 ATGCTGACCGCCTGTGATGCTGG - Intergenic
914105643 1:144648192-144648214 ATGCTGACCGCCTGTGATGCTGG + Intergenic
915344835 1:155192111-155192133 ATCCTGTCCCTGAGTGGTGGAGG + Intronic
915538240 1:156550598-156550620 ATGCAGAGCCTCTGTGGTTCTGG - Intronic
918053612 1:180998335-180998357 ATCCTTACCCGCGGTGGTGGTGG - Intronic
922786774 1:228286809-228286831 GTCCTCACCCTCTGTGATGGTGG - Exonic
923351667 1:233113419-233113441 ATGCTGACTCATAGTGGTGGGGG - Intronic
924569258 1:245223166-245223188 TAGCTGATTCTCTGTGGTGGGGG - Intronic
1063218402 10:3944173-3944195 ATGCTAACCCTCGGTGGGTGTGG + Intergenic
1064904764 10:20333870-20333892 ATGCTCACCCTCATTGGTGAGGG - Intergenic
1065046574 10:21751866-21751888 TTCCTGACCCTCTGTGGGCGGGG + Intergenic
1065059127 10:21879829-21879851 CTGCTGACTCACTGGGGTGGTGG + Intronic
1067778568 10:49180203-49180225 TTGCTGACACTGTGGGGTGGGGG - Intronic
1070958944 10:80485632-80485654 GTCCTGACCCTCTGTGGGGCTGG - Intronic
1072763981 10:98081258-98081280 CTGCCCACCCTCTGTGGTGCGGG - Intergenic
1073295937 10:102438706-102438728 ATGCAGATCCTCAGAGGTGGGGG + Intergenic
1074536467 10:114331795-114331817 ATGCTTACCATCTTGGGTGGCGG + Exonic
1074583704 10:114745686-114745708 ATGGTGAAACCCTGTGGTGGTGG + Intergenic
1076596861 10:131628630-131628652 ATCCTCACCCTGTGTGGTGCTGG - Intergenic
1076625970 10:131822284-131822306 CTGCTGACTGTCTGTGGGGGTGG - Intergenic
1077167474 11:1150337-1150359 ATGCTGCCCCTCCCTGATGGGGG - Intergenic
1077295540 11:1824776-1824798 AAGGTGACCCTCTGGGTTGGGGG + Intergenic
1077988488 11:7379698-7379720 ATCCTGACCCTCTCTCATGGTGG + Intronic
1083939460 11:65887911-65887933 GTGCTCACCCTCTGGGATGGTGG - Intronic
1087589985 11:100174810-100174832 ATGCTGAGCCCCAGGGGTGGTGG + Intronic
1090237325 11:125158864-125158886 ATGCTGGTCCTCTGTGGGGTCGG + Intergenic
1090831944 11:130426428-130426450 AAGCTGACACTTTGTGGTGATGG - Intronic
1091111492 11:132973026-132973048 TTGCTGACACTCTTTGGTGCAGG - Intronic
1094480202 12:30875394-30875416 ATGCTGACAGTCTGTGGAGATGG + Intergenic
1096157560 12:49348975-49348997 ATGCTGACCCTGGGGGGAGGTGG + Exonic
1098524566 12:71471779-71471801 ATAATGATCCTTTGTGGTGGGGG - Intronic
1101092638 12:101303543-101303565 ATGCCAACGCTCTGTGGGGGTGG + Intronic
1101194897 12:102371832-102371854 CTGCATACCCTCTGTGTTGGAGG + Intergenic
1101703888 12:107201926-107201948 ATGCTGACTTTCTTTGGAGGTGG - Intergenic
1102017988 12:109661109-109661131 ATCCTGGCTCTGTGTGGTGGGGG - Intergenic
1103226458 12:119292012-119292034 ATGATGAGCCTCTGTGAAGGTGG + Intergenic
1105220225 13:18318880-18318902 ATGCTGACCACCTGTGATGCTGG + Intergenic
1112990738 13:105510594-105510616 ATGCTGACCCGCTAAGCTGGCGG + Intergenic
1114268228 14:21085388-21085410 ATGCTTACCCTCTGTGCAGGGGG - Intronic
1114479785 14:23025549-23025571 AGGCTGTCACCCTGTGGTGGGGG - Intronic
1116856705 14:49958993-49959015 ATTCTGACCTTGAGTGGTGGAGG + Intergenic
1117714775 14:58569373-58569395 ATTTTGACCCTCAGTGCTGGAGG + Intergenic
1118907605 14:70033889-70033911 ATGCTCAGCCTCTGTGGGGCAGG + Intergenic
1122853398 14:104548563-104548585 ATGGGGAGCCTCTGTGTTGGTGG - Intronic
1202869827 14_GL000225v1_random:151576-151598 ATACTGACCATCTGTGATGCTGG + Intergenic
1123540473 15:21284833-21284855 ATTTTCACCCTCTGCGGTGGGGG + Intergenic
1125503010 15:40251262-40251284 ATGCTGGCCCTCTGTGCTGTGGG - Exonic
1125832109 15:42724392-42724414 ATGCAGACCCTCACTGGTTGGGG - Exonic
1126065897 15:44826175-44826197 ATGCTAATCTTCTGGGGTGGGGG + Intergenic
1126093937 15:45074391-45074413 ATGCTAATCTTCTGGGGTGGGGG - Exonic
1129392714 15:75228632-75228654 ATGCACACCCTCTGGCGTGGGGG + Intergenic
1130169068 15:81493156-81493178 ATGTTGACCTACTGTGGTGTTGG - Intergenic
1130864566 15:87921399-87921421 ATGCTGACCCTGTTTGGAGAGGG - Intronic
1202948787 15_KI270727v1_random:11975-11997 ATTTTCACCCTCTGCGGTGGGGG + Intergenic
1133198757 16:4189521-4189543 ATTCTGACTCTTTGGGGTGGGGG - Exonic
1135390127 16:22085507-22085529 ATGCTGAGCTGCTATGGTGGAGG + Intronic
1137932579 16:52603014-52603036 AAGCTGAGACTCTGTGTTGGAGG - Intergenic
1138373276 16:56544193-56544215 ATGATGACCGTCTGTGATTGGGG + Intergenic
1143769049 17:9156328-9156350 ATGGTGATCCTGTGTGCTGGAGG + Intronic
1144789572 17:17849934-17849956 AAGCTGACCTTCTGGGGAGGAGG + Intronic
1149276004 17:55038006-55038028 ATGCTGACTGTCTGTGAGGGTGG + Intronic
1149440075 17:56666550-56666572 ATACTGAACCTCTGTTGTTGAGG - Intergenic
1149596765 17:57868774-57868796 TTGCTAAGCCTCTGTGGGGGTGG - Intronic
1153720967 18:7902444-7902466 AGGCTGAAGCTCTGTGCTGGGGG + Intronic
1157340361 18:46772510-46772532 AGGCTGACCCCAAGTGGTGGTGG - Intergenic
1157894988 18:51457326-51457348 CTGCTGCTCCTCTGTGCTGGAGG - Intergenic
1158018417 18:52811149-52811171 AGGCTGATCCTTTGTGGTGAAGG - Intronic
1159657253 18:71046587-71046609 ATGCAAACCCTCTCTTGTGGTGG - Intergenic
1162796501 19:13090094-13090116 AGGGTGTCCCTCTGTAGTGGGGG + Intronic
1163069287 19:14824939-14824961 ATACTGACCAGGTGTGGTGGTGG + Intronic
1164885038 19:31771277-31771299 AATCTGAGCCTCTGTGGAGGGGG - Intergenic
1165195401 19:34098608-34098630 ATGCTCCACCTCTGTGGGGGTGG - Intergenic
1167149222 19:47699291-47699313 GGGCTCACCCTCTGGGGTGGGGG - Exonic
1167440026 19:49502911-49502933 AAACTGAGGCTCTGTGGTGGAGG - Intergenic
1167632233 19:50632340-50632362 CTGCTGCCCCCCAGTGGTGGGGG - Exonic
1167664968 19:50818558-50818580 ATGCTGGGCCTCTGGGGTGGAGG - Intergenic
1168507755 19:56950692-56950714 ATGCTCACACTCTGAGGTGCTGG - Intergenic
925319656 2:2952311-2952333 ACGCTGACCCTCTTGGCTGGTGG + Intergenic
927680406 2:25135411-25135433 ATGCTGTCCCTCTCAGGTGCAGG - Intronic
928595751 2:32857430-32857452 GTGCTCACCCTCTGGGGGGGTGG - Intergenic
929756225 2:44767962-44767984 ATGCTGAACGTCTTTGCTGGTGG - Intronic
930505881 2:52282494-52282516 GAGCTGACCCTCTTTGTTGGTGG - Intergenic
932117074 2:69061238-69061260 ATGCTTCTCCTCTCTGGTGGAGG - Intronic
932191806 2:69747213-69747235 ATGCTACCTCTCTGGGGTGGCGG - Intronic
932772230 2:74507046-74507068 ATGAAGACACTCTGTGATGGTGG + Exonic
934183826 2:89653599-89653621 ATGCTGACCGCCTGTGATGCTGG - Intergenic
934220360 2:90076562-90076584 ATGCTGACCCTAAGCTGTGGAGG - Intergenic
934294113 2:91727770-91727792 ATGCTGACCGCCTGTGATGCTGG - Intergenic
936432353 2:112475336-112475358 ATGCACAGCCTCTGTGGTGCAGG + Intergenic
936502078 2:113074481-113074503 CTGCTGACCCTCTGCTGGGGAGG - Intronic
936957130 2:118033792-118033814 ATGCTGACCGTTTCTGCTGGGGG + Intergenic
940787170 2:157993984-157994006 ATTGTGACCCTATGTGTTGGAGG - Intronic
941397678 2:164993337-164993359 ATTTTCACCCTCTGGGGTGGGGG + Intergenic
941640630 2:167983973-167983995 ATGTGGCCCCTCTGTGCTGGGGG + Intronic
941729551 2:168901198-168901220 ATGCTGACCATCTGTGGAGAGGG - Intronic
942605161 2:177683007-177683029 GTGCTGACCCTCTGTACTGGGGG + Intronic
944810421 2:203322233-203322255 ATGGTGAAACCCTGTGGTGGTGG - Intergenic
947117958 2:226791709-226791731 ATGCTGATTGGCTGTGGTGGGGG + Intronic
948440983 2:237988901-237988923 ATGCTGACCCTGTGTGTCTGGGG - Intronic
949060292 2:241953047-241953069 GTGCGCCCCCTCTGTGGTGGTGG + Intergenic
1170877396 20:20263116-20263138 ATCCTTACCTTCTGTGGTGATGG - Exonic
1171419548 20:25008671-25008693 ATTCTGACCCCCTGGGTTGGGGG + Intronic
1175507458 20:59495923-59495945 CTGGTGACCCTCTGTGGTGGGGG - Intergenic
1179379857 21:40888390-40888412 AGGCTGACCCTGTGTGCAGGTGG + Intergenic
1181053227 22:20247397-20247419 GCCCTGACCCTCTGTGGTGTGGG - Intronic
1181285053 22:21745992-21746014 ATGCAGACTCTCTGTGGGGAGGG - Intergenic
1182548626 22:31089625-31089647 AGCCTGGCCCTCAGTGGTGGGGG + Intronic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1184632083 22:45789658-45789680 ATCCAGCCCCTTTGTGGTGGTGG + Intronic
1184998623 22:48228124-48228146 ATACTGGCCCTTTGTGGTGTGGG - Intergenic
949692535 3:6656189-6656211 ATGCTGATCCTGAGTGTTGGAGG - Intergenic
949815381 3:8052752-8052774 ATGCTGGCTCTCTTTGGTAGTGG + Intergenic
952616133 3:35276297-35276319 ATGCTGCCCCTCTGTTGTGGGGG - Intergenic
954139958 3:48599754-48599776 ATGCTGACTGGCTGAGGTGGTGG - Intronic
955753302 3:62203828-62203850 ATACTGCTCCTCTGTGGCGGTGG - Exonic
956891212 3:73616004-73616026 ATGCTGTCCCAGGGTGGTGGTGG + Intronic
957231793 3:77527938-77527960 ATGCTTACCCTAAGTGGGGGAGG + Intronic
960058003 3:113289667-113289689 AGGCTGACCCTGTGTGATGTGGG - Exonic
960360571 3:116706024-116706046 ATGGTGAAACCCTGTGGTGGTGG - Intronic
964973725 3:162593432-162593454 ATGCTGACCCTGAGTATTGGGGG + Intergenic
965548166 3:169936557-169936579 TTGCTTTCCCTCTGTGGTTGAGG + Intronic
966643568 3:182217337-182217359 ATCTTGACCCTCTGGGGAGGAGG + Intergenic
968406661 4:345775-345797 TTGCTTATCTTCTGTGGTGGAGG - Intronic
968824845 4:2887634-2887656 ATGCTAAGCCTCTGAGGTGATGG + Intronic
969362987 4:6676996-6677018 GAGCTGACCATCTGAGGTGGTGG + Intergenic
969389402 4:6879696-6879718 ATGCTGACCATCTGGTGTAGGGG + Intronic
970365535 4:15354411-15354433 AAGCTGACCATGTGTGGGGGAGG + Intronic
971533839 4:27722801-27722823 TTGCTGACCTTCTGTGTAGGTGG + Intergenic
981786147 4:148481714-148481736 ATGCAGAACCTCGGAGGTGGAGG - Intergenic
982093461 4:151899482-151899504 AGGCAGCCCCTCTGTGGTGCTGG - Intergenic
982732126 4:158967310-158967332 ATGCTGACCATCTGTGAGGCGGG - Intronic
984818681 4:183861251-183861273 TTGTTGAACCTCAGTGGTGGGGG - Intronic
985390800 4:189490551-189490573 CTGCTGACCCTCGGTGGTGTGGG + Intergenic
985390809 4:189490581-189490603 TGGCTGACCCTCGGTGGTGTGGG + Intergenic
985390830 4:189490671-189490693 TGGCTGACCCTCGGTGGTGTAGG + Intergenic
985390861 4:189490791-189490813 TGGCTGACCCTCGGTGGTGTAGG + Intergenic
985390895 4:189490911-189490933 TGGCTGACCCTCGGTGGTGTGGG + Intergenic
985390904 4:189490941-189490963 TGGCTGACCCTCGGTGGTGTGGG + Intergenic
985390988 4:189491271-189491293 TGGCTGACCCTCGGTGGTGTGGG + Intergenic
985391035 4:189491451-189491473 TGGCTGACCCTCGGTGGTGTGGG + Intergenic
985391052 4:189491511-189491533 TGGCTGACCCTCGGTGGTGTGGG + Intergenic
985391069 4:189491571-189491593 TGGCTGACCCTCGGTGGTGTGGG + Intergenic
985391086 4:189491631-189491653 TGGCTGACCCTCGGTGGTGTGGG + Intergenic
985391132 4:189491811-189491833 TGGCTGACCCTCGGTGGTGTGGG + Intergenic
985391149 4:189491871-189491893 TGGCTGACCCTCGGTGGTGTGGG + Intergenic
985391174 4:189491961-189491983 TGGCTGACCCTCGGTGGTGTGGG + Intergenic
986404384 5:7411288-7411310 TGGCTCACCCTCTGAGGTGGGGG + Intronic
988534774 5:32057205-32057227 ATGCTGATTCTCTGTGCTTGGGG + Intronic
989142364 5:38214380-38214402 ATGCAGACCCTCTTCCGTGGTGG - Intergenic
991152891 5:63392524-63392546 ATGCTGACTTTCTGTAGTGCAGG - Intergenic
991522697 5:67518309-67518331 ATCCTGAGCCACAGTGGTGGAGG + Intergenic
997330835 5:133060131-133060153 ATAGTGGCCCTCTGTGGTGGGGG + Intronic
1000203594 5:159035965-159035987 TTCCTGACCCCCAGTGGTGGGGG + Intronic
1003500187 6:6696788-6696810 CTCCTGTCCCTCTGTGGTGAGGG + Intergenic
1005224976 6:23632188-23632210 TGGCTGTCCCTCTGTGGGGGTGG + Intergenic
1006168142 6:32077626-32077648 AGGCTGGTCCTGTGTGGTGGTGG + Intronic
1008535238 6:52502441-52502463 CTGCTGTCGCTCTGTGGGGGGGG - Exonic
1010569127 6:77456634-77456656 ATGGTGACCATATGTGGTGATGG - Intergenic
1011832146 6:91387127-91387149 ATGCTGAAACACTGTGGTGAAGG + Intergenic
1013829174 6:114252467-114252489 ATCCTGAACATCTGTGGAGGGGG + Intronic
1015783454 6:136895812-136895834 ATGCTGAAACTCTTTGGTGAAGG - Intronic
1018040558 6:159918184-159918206 ATGCTGAGCCACTGTCCTGGAGG - Intergenic
1020115280 7:5472724-5472746 CTGCTGAGTCACTGTGGTGGAGG + Intronic
1021438725 7:20652835-20652857 ATTGTGACCCTCTGGGATGGTGG - Intronic
1023868526 7:44250464-44250486 ATGCTGACTGTCTGCGGAGGGGG - Intronic
1029551061 7:101237358-101237380 ATGCTGGCCCTCTCTGGTATGGG - Exonic
1030854638 7:114539746-114539768 AGGCTGACACCCTGTGGAGGAGG + Intronic
1031033475 7:116760966-116760988 ATAGTGACCCTCTTTGGTGTTGG + Intronic
1038446939 8:27611018-27611040 ATGCAGTCCCTCTGTGGAGGTGG - Intronic
1039473038 8:37825935-37825957 ATGCCCACCCTCCGTGGAGGTGG + Intronic
1042655141 8:71087601-71087623 ATACTCACCTTTTGTGGTGGTGG + Intergenic
1044699379 8:94952045-94952067 AGGCTGACCCCCTGCTGTGGGGG + Intronic
1045510196 8:102807340-102807362 ATGCCGACCCTCTCCGGGGGAGG + Intergenic
1046318964 8:112545537-112545559 ATTCTGACCCTAGATGGTGGTGG - Intronic
1048319557 8:133387806-133387828 ATGCTCTCCCTCTGGGGTGGGGG + Intergenic
1049180861 8:141221457-141221479 AGGCTGACCCTCTGTGGGCCTGG - Intronic
1049767968 8:144363842-144363864 ATGCTGATCCTCTGTGTGTGGGG + Intergenic
1049814744 8:144592929-144592951 ATGCTGACCCTCTGTGGTGGAGG - Intronic
1050140840 9:2514262-2514284 ATACTGGCCCTCTGGAGTGGGGG - Intergenic
1053379607 9:37637475-37637497 ATTCTGTATCTCTGTGGTGGTGG - Intronic
1059277231 9:113107231-113107253 AGGCTGTCACACTGTGGTGGAGG - Intergenic
1059279020 9:113117320-113117342 AGGCTGTCACACTGTGGTGGAGG + Intergenic
1059676290 9:116543694-116543716 ATGTTGACCATCTGTGGATGAGG - Intronic
1062154461 9:135038961-135038983 AATCTGACCCTCAGTGTTGGAGG + Intergenic
1062193437 9:135259334-135259356 ATGCTGACCGTATGGGGTGACGG + Intergenic
1062602659 9:137325334-137325356 ATGTTGCCCCCCTGTGGTGTGGG - Intronic
1186339898 X:8633133-8633155 ATGCTAATCCTCTGTGATTGAGG - Intronic
1187016846 X:15337395-15337417 TTGCTGAGTCTCTGTGGGGGAGG + Intergenic
1187488725 X:19729478-19729500 CTGCTGATCCTCTCAGGTGGAGG - Intronic
1189273072 X:39765340-39765362 ATGCTGATGCTGTGGGGTGGGGG + Intergenic
1197930444 X:131689466-131689488 ATTGTGACCCTCAGTGTTGGAGG - Intergenic
1198115647 X:133542438-133542460 ATGCTCACCCTCTGAGGGTGTGG + Intronic
1199345482 X:146733886-146733908 ATGTGGACCCTCTGTGTTGGAGG + Intergenic