ID: 1049818653

View in Genome Browser
Species Human (GRCh38)
Location 8:144620949-144620971
Sequence CCAAGGGACGGGTCTGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049818653_1049818668 28 Left 1049818653 8:144620949-144620971 CCAGGCACAGACCCGTCCCTTGG No data
Right 1049818668 8:144621000-144621022 CCTGCTTTGCAGGAGGCACATGG No data
1049818653_1049818662 5 Left 1049818653 8:144620949-144620971 CCAGGCACAGACCCGTCCCTTGG No data
Right 1049818662 8:144620977-144620999 CCGCTGTCACCAGCCTGTGAAGG No data
1049818653_1049818666 21 Left 1049818653 8:144620949-144620971 CCAGGCACAGACCCGTCCCTTGG No data
Right 1049818666 8:144620993-144621015 GTGAAGGCCTGCTTTGCAGGAGG No data
1049818653_1049818665 18 Left 1049818653 8:144620949-144620971 CCAGGCACAGACCCGTCCCTTGG No data
Right 1049818665 8:144620990-144621012 CCTGTGAAGGCCTGCTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049818653 Original CRISPR CCAAGGGACGGGTCTGTGCC TGG (reversed) Intergenic
No off target data available for this crispr