ID: 1049818656

View in Genome Browser
Species Human (GRCh38)
Location 8:144620961-144620983
Sequence ACAGCGGGGCTGCCAAGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049818656_1049818673 26 Left 1049818656 8:144620961-144620983 CCGTCCCTTGGCAGCCCCGCTGT No data
Right 1049818673 8:144621010-144621032 AGGAGGCACATGGTTGGAGGGGG No data
1049818656_1049818670 23 Left 1049818656 8:144620961-144620983 CCGTCCCTTGGCAGCCCCGCTGT No data
Right 1049818670 8:144621007-144621029 TGCAGGAGGCACATGGTTGGAGG No data
1049818656_1049818665 6 Left 1049818656 8:144620961-144620983 CCGTCCCTTGGCAGCCCCGCTGT No data
Right 1049818665 8:144620990-144621012 CCTGTGAAGGCCTGCTTTGCAGG No data
1049818656_1049818666 9 Left 1049818656 8:144620961-144620983 CCGTCCCTTGGCAGCCCCGCTGT No data
Right 1049818666 8:144620993-144621015 GTGAAGGCCTGCTTTGCAGGAGG No data
1049818656_1049818662 -7 Left 1049818656 8:144620961-144620983 CCGTCCCTTGGCAGCCCCGCTGT No data
Right 1049818662 8:144620977-144620999 CCGCTGTCACCAGCCTGTGAAGG No data
1049818656_1049818669 20 Left 1049818656 8:144620961-144620983 CCGTCCCTTGGCAGCCCCGCTGT No data
Right 1049818669 8:144621004-144621026 CTTTGCAGGAGGCACATGGTTGG No data
1049818656_1049818668 16 Left 1049818656 8:144620961-144620983 CCGTCCCTTGGCAGCCCCGCTGT No data
Right 1049818668 8:144621000-144621022 CCTGCTTTGCAGGAGGCACATGG No data
1049818656_1049818672 25 Left 1049818656 8:144620961-144620983 CCGTCCCTTGGCAGCCCCGCTGT No data
Right 1049818672 8:144621009-144621031 CAGGAGGCACATGGTTGGAGGGG No data
1049818656_1049818671 24 Left 1049818656 8:144620961-144620983 CCGTCCCTTGGCAGCCCCGCTGT No data
Right 1049818671 8:144621008-144621030 GCAGGAGGCACATGGTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049818656 Original CRISPR ACAGCGGGGCTGCCAAGGGA CGG (reversed) Intergenic
No off target data available for this crispr