ID: 1049818657

View in Genome Browser
Species Human (GRCh38)
Location 8:144620965-144620987
Sequence GGTGACAGCGGGGCTGCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049818657_1049818665 2 Left 1049818657 8:144620965-144620987 CCCTTGGCAGCCCCGCTGTCACC No data
Right 1049818665 8:144620990-144621012 CCTGTGAAGGCCTGCTTTGCAGG No data
1049818657_1049818670 19 Left 1049818657 8:144620965-144620987 CCCTTGGCAGCCCCGCTGTCACC No data
Right 1049818670 8:144621007-144621029 TGCAGGAGGCACATGGTTGGAGG No data
1049818657_1049818672 21 Left 1049818657 8:144620965-144620987 CCCTTGGCAGCCCCGCTGTCACC No data
Right 1049818672 8:144621009-144621031 CAGGAGGCACATGGTTGGAGGGG No data
1049818657_1049818673 22 Left 1049818657 8:144620965-144620987 CCCTTGGCAGCCCCGCTGTCACC No data
Right 1049818673 8:144621010-144621032 AGGAGGCACATGGTTGGAGGGGG No data
1049818657_1049818669 16 Left 1049818657 8:144620965-144620987 CCCTTGGCAGCCCCGCTGTCACC No data
Right 1049818669 8:144621004-144621026 CTTTGCAGGAGGCACATGGTTGG No data
1049818657_1049818671 20 Left 1049818657 8:144620965-144620987 CCCTTGGCAGCCCCGCTGTCACC No data
Right 1049818671 8:144621008-144621030 GCAGGAGGCACATGGTTGGAGGG No data
1049818657_1049818668 12 Left 1049818657 8:144620965-144620987 CCCTTGGCAGCCCCGCTGTCACC No data
Right 1049818668 8:144621000-144621022 CCTGCTTTGCAGGAGGCACATGG No data
1049818657_1049818666 5 Left 1049818657 8:144620965-144620987 CCCTTGGCAGCCCCGCTGTCACC No data
Right 1049818666 8:144620993-144621015 GTGAAGGCCTGCTTTGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049818657 Original CRISPR GGTGACAGCGGGGCTGCCAA GGG (reversed) Intergenic
No off target data available for this crispr