ID: 1049818663

View in Genome Browser
Species Human (GRCh38)
Location 8:144620986-144621008
Sequence CAAAGCAGGCCTTCACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049818663_1049818668 -9 Left 1049818663 8:144620986-144621008 CCAGCCTGTGAAGGCCTGCTTTG No data
Right 1049818668 8:144621000-144621022 CCTGCTTTGCAGGAGGCACATGG No data
1049818663_1049818675 30 Left 1049818663 8:144620986-144621008 CCAGCCTGTGAAGGCCTGCTTTG No data
Right 1049818675 8:144621039-144621061 TCACCACCCAGAGCCCCAGTTGG No data
1049818663_1049818671 -1 Left 1049818663 8:144620986-144621008 CCAGCCTGTGAAGGCCTGCTTTG No data
Right 1049818671 8:144621008-144621030 GCAGGAGGCACATGGTTGGAGGG No data
1049818663_1049818673 1 Left 1049818663 8:144620986-144621008 CCAGCCTGTGAAGGCCTGCTTTG No data
Right 1049818673 8:144621010-144621032 AGGAGGCACATGGTTGGAGGGGG No data
1049818663_1049818672 0 Left 1049818663 8:144620986-144621008 CCAGCCTGTGAAGGCCTGCTTTG No data
Right 1049818672 8:144621009-144621031 CAGGAGGCACATGGTTGGAGGGG No data
1049818663_1049818669 -5 Left 1049818663 8:144620986-144621008 CCAGCCTGTGAAGGCCTGCTTTG No data
Right 1049818669 8:144621004-144621026 CTTTGCAGGAGGCACATGGTTGG No data
1049818663_1049818670 -2 Left 1049818663 8:144620986-144621008 CCAGCCTGTGAAGGCCTGCTTTG No data
Right 1049818670 8:144621007-144621029 TGCAGGAGGCACATGGTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049818663 Original CRISPR CAAAGCAGGCCTTCACAGGC TGG (reversed) Intergenic
No off target data available for this crispr