ID: 1049818665

View in Genome Browser
Species Human (GRCh38)
Location 8:144620990-144621012
Sequence CCTGTGAAGGCCTGCTTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049818656_1049818665 6 Left 1049818656 8:144620961-144620983 CCGTCCCTTGGCAGCCCCGCTGT No data
Right 1049818665 8:144620990-144621012 CCTGTGAAGGCCTGCTTTGCAGG No data
1049818658_1049818665 1 Left 1049818658 8:144620966-144620988 CCTTGGCAGCCCCGCTGTCACCA No data
Right 1049818665 8:144620990-144621012 CCTGTGAAGGCCTGCTTTGCAGG No data
1049818661_1049818665 -10 Left 1049818661 8:144620977-144620999 CCGCTGTCACCAGCCTGTGAAGG No data
Right 1049818665 8:144620990-144621012 CCTGTGAAGGCCTGCTTTGCAGG No data
1049818657_1049818665 2 Left 1049818657 8:144620965-144620987 CCCTTGGCAGCCCCGCTGTCACC No data
Right 1049818665 8:144620990-144621012 CCTGTGAAGGCCTGCTTTGCAGG No data
1049818653_1049818665 18 Left 1049818653 8:144620949-144620971 CCAGGCACAGACCCGTCCCTTGG No data
Right 1049818665 8:144620990-144621012 CCTGTGAAGGCCTGCTTTGCAGG No data
1049818659_1049818665 -8 Left 1049818659 8:144620975-144620997 CCCCGCTGTCACCAGCCTGTGAA No data
Right 1049818665 8:144620990-144621012 CCTGTGAAGGCCTGCTTTGCAGG No data
1049818660_1049818665 -9 Left 1049818660 8:144620976-144620998 CCCGCTGTCACCAGCCTGTGAAG No data
Right 1049818665 8:144620990-144621012 CCTGTGAAGGCCTGCTTTGCAGG No data
1049818655_1049818665 7 Left 1049818655 8:144620960-144620982 CCCGTCCCTTGGCAGCCCCGCTG No data
Right 1049818665 8:144620990-144621012 CCTGTGAAGGCCTGCTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049818665 Original CRISPR CCTGTGAAGGCCTGCTTTGC AGG Intergenic
No off target data available for this crispr