ID: 1049818673

View in Genome Browser
Species Human (GRCh38)
Location 8:144621010-144621032
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049818659_1049818673 12 Left 1049818659 8:144620975-144620997 CCCCGCTGTCACCAGCCTGTGAA No data
Right 1049818673 8:144621010-144621032 AGGAGGCACATGGTTGGAGGGGG No data
1049818656_1049818673 26 Left 1049818656 8:144620961-144620983 CCGTCCCTTGGCAGCCCCGCTGT No data
Right 1049818673 8:144621010-144621032 AGGAGGCACATGGTTGGAGGGGG No data
1049818664_1049818673 -3 Left 1049818664 8:144620990-144621012 CCTGTGAAGGCCTGCTTTGCAGG No data
Right 1049818673 8:144621010-144621032 AGGAGGCACATGGTTGGAGGGGG No data
1049818657_1049818673 22 Left 1049818657 8:144620965-144620987 CCCTTGGCAGCCCCGCTGTCACC No data
Right 1049818673 8:144621010-144621032 AGGAGGCACATGGTTGGAGGGGG No data
1049818658_1049818673 21 Left 1049818658 8:144620966-144620988 CCTTGGCAGCCCCGCTGTCACCA No data
Right 1049818673 8:144621010-144621032 AGGAGGCACATGGTTGGAGGGGG No data
1049818661_1049818673 10 Left 1049818661 8:144620977-144620999 CCGCTGTCACCAGCCTGTGAAGG No data
Right 1049818673 8:144621010-144621032 AGGAGGCACATGGTTGGAGGGGG No data
1049818663_1049818673 1 Left 1049818663 8:144620986-144621008 CCAGCCTGTGAAGGCCTGCTTTG No data
Right 1049818673 8:144621010-144621032 AGGAGGCACATGGTTGGAGGGGG No data
1049818660_1049818673 11 Left 1049818660 8:144620976-144620998 CCCGCTGTCACCAGCCTGTGAAG No data
Right 1049818673 8:144621010-144621032 AGGAGGCACATGGTTGGAGGGGG No data
1049818655_1049818673 27 Left 1049818655 8:144620960-144620982 CCCGTCCCTTGGCAGCCCCGCTG No data
Right 1049818673 8:144621010-144621032 AGGAGGCACATGGTTGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049818673 Original CRISPR AGGAGGCACATGGTTGGAGG GGG Intergenic
No off target data available for this crispr