ID: 1049819070

View in Genome Browser
Species Human (GRCh38)
Location 8:144623296-144623318
Sequence CAGAGTACAAGGAAAGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049819065_1049819070 21 Left 1049819065 8:144623252-144623274 CCAAAAGAAGTCAAGAAACGAAA No data
Right 1049819070 8:144623296-144623318 CAGAGTACAAGGAAAGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049819070 Original CRISPR CAGAGTACAAGGAAAGATGG TGG Intergenic
No off target data available for this crispr