ID: 1049820354

View in Genome Browser
Species Human (GRCh38)
Location 8:144629712-144629734
Sequence AGACCTGTGCTGGCAGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049820347_1049820354 -6 Left 1049820347 8:144629695-144629717 CCCAGGGGCCTGGGGCCAGACCT No data
Right 1049820354 8:144629712-144629734 AGACCTGTGCTGGCAGAGGGTGG No data
1049820348_1049820354 -7 Left 1049820348 8:144629696-144629718 CCAGGGGCCTGGGGCCAGACCTG No data
Right 1049820354 8:144629712-144629734 AGACCTGTGCTGGCAGAGGGTGG No data
1049820339_1049820354 29 Left 1049820339 8:144629660-144629682 CCGGGTGATGGCATTGACAGCAA No data
Right 1049820354 8:144629712-144629734 AGACCTGTGCTGGCAGAGGGTGG No data
1049820346_1049820354 0 Left 1049820346 8:144629689-144629711 CCTCTGCCCAGGGGCCTGGGGCC No data
Right 1049820354 8:144629712-144629734 AGACCTGTGCTGGCAGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049820354 Original CRISPR AGACCTGTGCTGGCAGAGGG TGG Intergenic
No off target data available for this crispr