ID: 1049820726

View in Genome Browser
Species Human (GRCh38)
Location 8:144631666-144631688
Sequence GACCCAGAGGTGCTTACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049820726_1049820729 -8 Left 1049820726 8:144631666-144631688 CCTGGTGTAAGCACCTCTGGGTC No data
Right 1049820729 8:144631681-144631703 TCTGGGTCTCCCTTGGCAGTTGG No data
1049820726_1049820736 19 Left 1049820726 8:144631666-144631688 CCTGGTGTAAGCACCTCTGGGTC No data
Right 1049820736 8:144631708-144631730 CCCAAAGAAACCTGTGCAGAGGG No data
1049820726_1049820738 24 Left 1049820726 8:144631666-144631688 CCTGGTGTAAGCACCTCTGGGTC No data
Right 1049820738 8:144631713-144631735 AGAAACCTGTGCAGAGGGAAAGG No data
1049820726_1049820734 18 Left 1049820726 8:144631666-144631688 CCTGGTGTAAGCACCTCTGGGTC No data
Right 1049820734 8:144631707-144631729 CCCCAAAGAAACCTGTGCAGAGG No data
1049820726_1049820740 29 Left 1049820726 8:144631666-144631688 CCTGGTGTAAGCACCTCTGGGTC No data
Right 1049820740 8:144631718-144631740 CCTGTGCAGAGGGAAAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049820726 Original CRISPR GACCCAGAGGTGCTTACACC AGG (reversed) Intergenic
No off target data available for this crispr