ID: 1049822543

View in Genome Browser
Species Human (GRCh38)
Location 8:144644941-144644963
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049822543_1049822550 -1 Left 1049822543 8:144644941-144644963 CCCTGCCCAGTGCGCCCATTCAG No data
Right 1049822550 8:144644963-144644985 GGACAGAAGTCAGTCCTCGCAGG No data
1049822543_1049822552 11 Left 1049822543 8:144644941-144644963 CCCTGCCCAGTGCGCCCATTCAG No data
Right 1049822552 8:144644975-144644997 GTCCTCGCAGGCTTGTCCCTGGG No data
1049822543_1049822554 14 Left 1049822543 8:144644941-144644963 CCCTGCCCAGTGCGCCCATTCAG No data
Right 1049822554 8:144644978-144645000 CTCGCAGGCTTGTCCCTGGGTGG No data
1049822543_1049822556 25 Left 1049822543 8:144644941-144644963 CCCTGCCCAGTGCGCCCATTCAG No data
Right 1049822556 8:144644989-144645011 GTCCCTGGGTGGCAGGTGACAGG No data
1049822543_1049822551 10 Left 1049822543 8:144644941-144644963 CCCTGCCCAGTGCGCCCATTCAG No data
Right 1049822551 8:144644974-144644996 AGTCCTCGCAGGCTTGTCCCTGG No data
1049822543_1049822555 18 Left 1049822543 8:144644941-144644963 CCCTGCCCAGTGCGCCCATTCAG No data
Right 1049822555 8:144644982-144645004 CAGGCTTGTCCCTGGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049822543 Original CRISPR CTGAATGGGCGCACTGGGCA GGG (reversed) Intergenic