ID: 1049822546

View in Genome Browser
Species Human (GRCh38)
Location 8:144644946-144644968
Sequence CTGTCCTGAATGGGCGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049822546_1049822560 27 Left 1049822546 8:144644946-144644968 CCCAGTGCGCCCATTCAGGACAG No data
Right 1049822560 8:144644996-144645018 GGTGGCAGGTGACAGGCGCTGGG No data
1049822546_1049822552 6 Left 1049822546 8:144644946-144644968 CCCAGTGCGCCCATTCAGGACAG No data
Right 1049822552 8:144644975-144644997 GTCCTCGCAGGCTTGTCCCTGGG No data
1049822546_1049822550 -6 Left 1049822546 8:144644946-144644968 CCCAGTGCGCCCATTCAGGACAG No data
Right 1049822550 8:144644963-144644985 GGACAGAAGTCAGTCCTCGCAGG No data
1049822546_1049822555 13 Left 1049822546 8:144644946-144644968 CCCAGTGCGCCCATTCAGGACAG No data
Right 1049822555 8:144644982-144645004 CAGGCTTGTCCCTGGGTGGCAGG No data
1049822546_1049822551 5 Left 1049822546 8:144644946-144644968 CCCAGTGCGCCCATTCAGGACAG No data
Right 1049822551 8:144644974-144644996 AGTCCTCGCAGGCTTGTCCCTGG No data
1049822546_1049822554 9 Left 1049822546 8:144644946-144644968 CCCAGTGCGCCCATTCAGGACAG No data
Right 1049822554 8:144644978-144645000 CTCGCAGGCTTGTCCCTGGGTGG No data
1049822546_1049822556 20 Left 1049822546 8:144644946-144644968 CCCAGTGCGCCCATTCAGGACAG No data
Right 1049822556 8:144644989-144645011 GTCCCTGGGTGGCAGGTGACAGG No data
1049822546_1049822559 26 Left 1049822546 8:144644946-144644968 CCCAGTGCGCCCATTCAGGACAG No data
Right 1049822559 8:144644995-144645017 GGGTGGCAGGTGACAGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049822546 Original CRISPR CTGTCCTGAATGGGCGCACT GGG (reversed) Intergenic