ID: 1049822547

View in Genome Browser
Species Human (GRCh38)
Location 8:144644947-144644969
Sequence TCTGTCCTGAATGGGCGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049822547_1049822559 25 Left 1049822547 8:144644947-144644969 CCAGTGCGCCCATTCAGGACAGA No data
Right 1049822559 8:144644995-144645017 GGGTGGCAGGTGACAGGCGCTGG No data
1049822547_1049822560 26 Left 1049822547 8:144644947-144644969 CCAGTGCGCCCATTCAGGACAGA No data
Right 1049822560 8:144644996-144645018 GGTGGCAGGTGACAGGCGCTGGG No data
1049822547_1049822556 19 Left 1049822547 8:144644947-144644969 CCAGTGCGCCCATTCAGGACAGA No data
Right 1049822556 8:144644989-144645011 GTCCCTGGGTGGCAGGTGACAGG No data
1049822547_1049822550 -7 Left 1049822547 8:144644947-144644969 CCAGTGCGCCCATTCAGGACAGA No data
Right 1049822550 8:144644963-144644985 GGACAGAAGTCAGTCCTCGCAGG No data
1049822547_1049822554 8 Left 1049822547 8:144644947-144644969 CCAGTGCGCCCATTCAGGACAGA No data
Right 1049822554 8:144644978-144645000 CTCGCAGGCTTGTCCCTGGGTGG No data
1049822547_1049822552 5 Left 1049822547 8:144644947-144644969 CCAGTGCGCCCATTCAGGACAGA No data
Right 1049822552 8:144644975-144644997 GTCCTCGCAGGCTTGTCCCTGGG No data
1049822547_1049822555 12 Left 1049822547 8:144644947-144644969 CCAGTGCGCCCATTCAGGACAGA No data
Right 1049822555 8:144644982-144645004 CAGGCTTGTCCCTGGGTGGCAGG No data
1049822547_1049822551 4 Left 1049822547 8:144644947-144644969 CCAGTGCGCCCATTCAGGACAGA No data
Right 1049822551 8:144644974-144644996 AGTCCTCGCAGGCTTGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049822547 Original CRISPR TCTGTCCTGAATGGGCGCAC TGG (reversed) Intergenic