ID: 1049822548

View in Genome Browser
Species Human (GRCh38)
Location 8:144644955-144644977
Sequence GACTGACTTCTGTCCTGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049822548_1049822555 4 Left 1049822548 8:144644955-144644977 CCCATTCAGGACAGAAGTCAGTC No data
Right 1049822555 8:144644982-144645004 CAGGCTTGTCCCTGGGTGGCAGG No data
1049822548_1049822551 -4 Left 1049822548 8:144644955-144644977 CCCATTCAGGACAGAAGTCAGTC No data
Right 1049822551 8:144644974-144644996 AGTCCTCGCAGGCTTGTCCCTGG No data
1049822548_1049822559 17 Left 1049822548 8:144644955-144644977 CCCATTCAGGACAGAAGTCAGTC No data
Right 1049822559 8:144644995-144645017 GGGTGGCAGGTGACAGGCGCTGG No data
1049822548_1049822560 18 Left 1049822548 8:144644955-144644977 CCCATTCAGGACAGAAGTCAGTC No data
Right 1049822560 8:144644996-144645018 GGTGGCAGGTGACAGGCGCTGGG No data
1049822548_1049822554 0 Left 1049822548 8:144644955-144644977 CCCATTCAGGACAGAAGTCAGTC No data
Right 1049822554 8:144644978-144645000 CTCGCAGGCTTGTCCCTGGGTGG No data
1049822548_1049822552 -3 Left 1049822548 8:144644955-144644977 CCCATTCAGGACAGAAGTCAGTC No data
Right 1049822552 8:144644975-144644997 GTCCTCGCAGGCTTGTCCCTGGG No data
1049822548_1049822561 24 Left 1049822548 8:144644955-144644977 CCCATTCAGGACAGAAGTCAGTC No data
Right 1049822561 8:144645002-144645024 AGGTGACAGGCGCTGGGCCACGG No data
1049822548_1049822556 11 Left 1049822548 8:144644955-144644977 CCCATTCAGGACAGAAGTCAGTC No data
Right 1049822556 8:144644989-144645011 GTCCCTGGGTGGCAGGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049822548 Original CRISPR GACTGACTTCTGTCCTGAAT GGG (reversed) Intergenic