ID: 1049822552

View in Genome Browser
Species Human (GRCh38)
Location 8:144644975-144644997
Sequence GTCCTCGCAGGCTTGTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049822546_1049822552 6 Left 1049822546 8:144644946-144644968 CCCAGTGCGCCCATTCAGGACAG No data
Right 1049822552 8:144644975-144644997 GTCCTCGCAGGCTTGTCCCTGGG No data
1049822547_1049822552 5 Left 1049822547 8:144644947-144644969 CCAGTGCGCCCATTCAGGACAGA No data
Right 1049822552 8:144644975-144644997 GTCCTCGCAGGCTTGTCCCTGGG No data
1049822542_1049822552 16 Left 1049822542 8:144644936-144644958 CCACACCCTGCCCAGTGCGCCCA No data
Right 1049822552 8:144644975-144644997 GTCCTCGCAGGCTTGTCCCTGGG No data
1049822548_1049822552 -3 Left 1049822548 8:144644955-144644977 CCCATTCAGGACAGAAGTCAGTC No data
Right 1049822552 8:144644975-144644997 GTCCTCGCAGGCTTGTCCCTGGG No data
1049822541_1049822552 24 Left 1049822541 8:144644928-144644950 CCGTGCTGCCACACCCTGCCCAG No data
Right 1049822552 8:144644975-144644997 GTCCTCGCAGGCTTGTCCCTGGG No data
1049822543_1049822552 11 Left 1049822543 8:144644941-144644963 CCCTGCCCAGTGCGCCCATTCAG No data
Right 1049822552 8:144644975-144644997 GTCCTCGCAGGCTTGTCCCTGGG No data
1049822549_1049822552 -4 Left 1049822549 8:144644956-144644978 CCATTCAGGACAGAAGTCAGTCC No data
Right 1049822552 8:144644975-144644997 GTCCTCGCAGGCTTGTCCCTGGG No data
1049822544_1049822552 10 Left 1049822544 8:144644942-144644964 CCTGCCCAGTGCGCCCATTCAGG No data
Right 1049822552 8:144644975-144644997 GTCCTCGCAGGCTTGTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049822552 Original CRISPR GTCCTCGCAGGCTTGTCCCT GGG Intergenic
No off target data available for this crispr