ID: 1049824003

View in Genome Browser
Species Human (GRCh38)
Location 8:144655250-144655272
Sequence GCTGATGGGTGGCCATGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049824003_1049824010 -1 Left 1049824003 8:144655250-144655272 CCCACCCATGGCCACCCATCAGC No data
Right 1049824010 8:144655272-144655294 CATGCAATTCCTCCCCTCTGAGG No data
1049824003_1049824015 15 Left 1049824003 8:144655250-144655272 CCCACCCATGGCCACCCATCAGC No data
Right 1049824015 8:144655288-144655310 TCTGAGGCCCATAAAAGCCCCGG 0: 40
1: 124
2: 129
3: 129
4: 256
1049824003_1049824016 16 Left 1049824003 8:144655250-144655272 CCCACCCATGGCCACCCATCAGC No data
Right 1049824016 8:144655289-144655311 CTGAGGCCCATAAAAGCCCCGGG 0: 33
1: 85
2: 148
3: 143
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049824003 Original CRISPR GCTGATGGGTGGCCATGGGT GGG (reversed) Intergenic
No off target data available for this crispr