ID: 1049827402

View in Genome Browser
Species Human (GRCh38)
Location 8:144678435-144678457
Sequence TCAGACTCAGGTAATGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049827402_1049827407 8 Left 1049827402 8:144678435-144678457 CCACAGACATTACCTGAGTCTGA No data
Right 1049827407 8:144678466-144678488 GCTGAAGGAACCAGTGAGCTTGG No data
1049827402_1049827406 -7 Left 1049827402 8:144678435-144678457 CCACAGACATTACCTGAGTCTGA No data
Right 1049827406 8:144678451-144678473 AGTCTGAGTCAAAGGGCTGAAGG No data
1049827402_1049827409 19 Left 1049827402 8:144678435-144678457 CCACAGACATTACCTGAGTCTGA No data
Right 1049827409 8:144678477-144678499 CAGTGAGCTTGGCTTAGTTTTGG No data
1049827402_1049827412 27 Left 1049827402 8:144678435-144678457 CCACAGACATTACCTGAGTCTGA No data
Right 1049827412 8:144678485-144678507 TTGGCTTAGTTTTGGAAGGAGGG No data
1049827402_1049827411 26 Left 1049827402 8:144678435-144678457 CCACAGACATTACCTGAGTCTGA No data
Right 1049827411 8:144678484-144678506 CTTGGCTTAGTTTTGGAAGGAGG No data
1049827402_1049827410 23 Left 1049827402 8:144678435-144678457 CCACAGACATTACCTGAGTCTGA No data
Right 1049827410 8:144678481-144678503 GAGCTTGGCTTAGTTTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049827402 Original CRISPR TCAGACTCAGGTAATGTCTG TGG (reversed) Intergenic
No off target data available for this crispr