ID: 1049828259

View in Genome Browser
Species Human (GRCh38)
Location 8:144684573-144684595
Sequence GCTGCTGGTGGGAAGCGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049828252_1049828259 2 Left 1049828252 8:144684548-144684570 CCGAAGCTGCGCAGCGCCCACAG No data
Right 1049828259 8:144684573-144684595 GCTGCTGGTGGGAAGCGGCTCGG No data
1049828250_1049828259 15 Left 1049828250 8:144684535-144684557 CCCGGCTGCGTTTCCGAAGCTGC No data
Right 1049828259 8:144684573-144684595 GCTGCTGGTGGGAAGCGGCTCGG No data
1049828251_1049828259 14 Left 1049828251 8:144684536-144684558 CCGGCTGCGTTTCCGAAGCTGCG No data
Right 1049828259 8:144684573-144684595 GCTGCTGGTGGGAAGCGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049828259 Original CRISPR GCTGCTGGTGGGAAGCGGCT CGG Intergenic
No off target data available for this crispr