ID: 1049828420

View in Genome Browser
Species Human (GRCh38)
Location 8:144685146-144685168
Sequence CACTCACACCTCCCTCGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049828401_1049828420 30 Left 1049828401 8:144685093-144685115 CCCTCACACCCCCCTCGGGCAGG No data
Right 1049828420 8:144685146-144685168 CACTCACACCTCCCTCGGGCAGG No data
1049828407_1049828420 21 Left 1049828407 8:144685102-144685124 CCCCCTCGGGCAGGGGCACACTC No data
Right 1049828420 8:144685146-144685168 CACTCACACCTCCCTCGGGCAGG No data
1049828408_1049828420 20 Left 1049828408 8:144685103-144685125 CCCCTCGGGCAGGGGCACACTCA No data
Right 1049828420 8:144685146-144685168 CACTCACACCTCCCTCGGGCAGG No data
1049828410_1049828420 18 Left 1049828410 8:144685105-144685127 CCTCGGGCAGGGGCACACTCACA No data
Right 1049828420 8:144685146-144685168 CACTCACACCTCCCTCGGGCAGG No data
1049828409_1049828420 19 Left 1049828409 8:144685104-144685126 CCCTCGGGCAGGGGCACACTCAC No data
Right 1049828420 8:144685146-144685168 CACTCACACCTCCCTCGGGCAGG No data
1049828416_1049828420 -6 Left 1049828416 8:144685129-144685151 CCATCTAGGGCCGGGCACACTCA No data
Right 1049828420 8:144685146-144685168 CACTCACACCTCCCTCGGGCAGG No data
1049828406_1049828420 22 Left 1049828406 8:144685101-144685123 CCCCCCTCGGGCAGGGGCACACT No data
Right 1049828420 8:144685146-144685168 CACTCACACCTCCCTCGGGCAGG No data
1049828403_1049828420 29 Left 1049828403 8:144685094-144685116 CCTCACACCCCCCTCGGGCAGGG No data
Right 1049828420 8:144685146-144685168 CACTCACACCTCCCTCGGGCAGG No data
1049828415_1049828420 -5 Left 1049828415 8:144685128-144685150 CCCATCTAGGGCCGGGCACACTC No data
Right 1049828420 8:144685146-144685168 CACTCACACCTCCCTCGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049828420 Original CRISPR CACTCACACCTCCCTCGGGC AGG Intergenic
No off target data available for this crispr