ID: 1049832814

View in Genome Browser
Species Human (GRCh38)
Location 8:144713166-144713188
Sequence TCTCAGAGCAGACCGAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049832812_1049832814 0 Left 1049832812 8:144713143-144713165 CCGAGTGGGCGGTCATCCGGGTG No data
Right 1049832814 8:144713166-144713188 TCTCAGAGCAGACCGAGAGCAGG No data
1049832804_1049832814 22 Left 1049832804 8:144713121-144713143 CCTGTCGGGGACCGTTGAACCAC No data
Right 1049832814 8:144713166-144713188 TCTCAGAGCAGACCGAGAGCAGG No data
1049832807_1049832814 11 Left 1049832807 8:144713132-144713154 CCGTTGAACCACCGAGTGGGCGG No data
Right 1049832814 8:144713166-144713188 TCTCAGAGCAGACCGAGAGCAGG No data
1049832803_1049832814 30 Left 1049832803 8:144713113-144713135 CCGGAGCTCCTGTCGGGGACCGT No data
Right 1049832814 8:144713166-144713188 TCTCAGAGCAGACCGAGAGCAGG No data
1049832809_1049832814 3 Left 1049832809 8:144713140-144713162 CCACCGAGTGGGCGGTCATCCGG No data
Right 1049832814 8:144713166-144713188 TCTCAGAGCAGACCGAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049832814 Original CRISPR TCTCAGAGCAGACCGAGAGC AGG Intergenic
No off target data available for this crispr