ID: 1049832825

View in Genome Browser
Species Human (GRCh38)
Location 8:144713226-144713248
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049832825_1049832831 1 Left 1049832825 8:144713226-144713248 CCCAACAGGTTTCCGCCCGGGGT No data
Right 1049832831 8:144713250-144713272 ACCGGCCGCAGTGCTCCTTTCGG No data
1049832825_1049832837 17 Left 1049832825 8:144713226-144713248 CCCAACAGGTTTCCGCCCGGGGT No data
Right 1049832837 8:144713266-144713288 CTTTCGGCTCCAGGGAAGCGCGG No data
1049832825_1049832835 9 Left 1049832825 8:144713226-144713248 CCCAACAGGTTTCCGCCCGGGGT No data
Right 1049832835 8:144713258-144713280 CAGTGCTCCTTTCGGCTCCAGGG No data
1049832825_1049832834 8 Left 1049832825 8:144713226-144713248 CCCAACAGGTTTCCGCCCGGGGT No data
Right 1049832834 8:144713257-144713279 GCAGTGCTCCTTTCGGCTCCAGG 0: 1
1: 0
2: 2
3: 13
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049832825 Original CRISPR ACCCCGGGCGGAAACCTGTT GGG (reversed) Intergenic