ID: 1049832826

View in Genome Browser
Species Human (GRCh38)
Location 8:144713227-144713249
Sequence GACCCCGGGCGGAAACCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049832826_1049832831 0 Left 1049832826 8:144713227-144713249 CCAACAGGTTTCCGCCCGGGGTC No data
Right 1049832831 8:144713250-144713272 ACCGGCCGCAGTGCTCCTTTCGG No data
1049832826_1049832835 8 Left 1049832826 8:144713227-144713249 CCAACAGGTTTCCGCCCGGGGTC No data
Right 1049832835 8:144713258-144713280 CAGTGCTCCTTTCGGCTCCAGGG No data
1049832826_1049832837 16 Left 1049832826 8:144713227-144713249 CCAACAGGTTTCCGCCCGGGGTC No data
Right 1049832837 8:144713266-144713288 CTTTCGGCTCCAGGGAAGCGCGG No data
1049832826_1049832834 7 Left 1049832826 8:144713227-144713249 CCAACAGGTTTCCGCCCGGGGTC No data
Right 1049832834 8:144713257-144713279 GCAGTGCTCCTTTCGGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049832826 Original CRISPR GACCCCGGGCGGAAACCTGT TGG (reversed) Intergenic