ID: 1049832828

View in Genome Browser
Species Human (GRCh38)
Location 8:144713238-144713260
Sequence CTGCGGCCGGTGACCCCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049832828_1049832839 28 Left 1049832828 8:144713238-144713260 CCGCCCGGGGTCACCGGCCGCAG No data
Right 1049832839 8:144713289-144713311 ACTCGCCCCTGCTGCCCGCCCGG No data
1049832828_1049832834 -4 Left 1049832828 8:144713238-144713260 CCGCCCGGGGTCACCGGCCGCAG No data
Right 1049832834 8:144713257-144713279 GCAGTGCTCCTTTCGGCTCCAGG No data
1049832828_1049832837 5 Left 1049832828 8:144713238-144713260 CCGCCCGGGGTCACCGGCCGCAG No data
Right 1049832837 8:144713266-144713288 CTTTCGGCTCCAGGGAAGCGCGG No data
1049832828_1049832835 -3 Left 1049832828 8:144713238-144713260 CCGCCCGGGGTCACCGGCCGCAG No data
Right 1049832835 8:144713258-144713280 CAGTGCTCCTTTCGGCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049832828 Original CRISPR CTGCGGCCGGTGACCCCGGG CGG (reversed) Intergenic