ID: 1049832829

View in Genome Browser
Species Human (GRCh38)
Location 8:144713241-144713263
Sequence GCACTGCGGCCGGTGACCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049832829_1049832835 -6 Left 1049832829 8:144713241-144713263 CCCGGGGTCACCGGCCGCAGTGC No data
Right 1049832835 8:144713258-144713280 CAGTGCTCCTTTCGGCTCCAGGG No data
1049832829_1049832834 -7 Left 1049832829 8:144713241-144713263 CCCGGGGTCACCGGCCGCAGTGC No data
Right 1049832834 8:144713257-144713279 GCAGTGCTCCTTTCGGCTCCAGG No data
1049832829_1049832837 2 Left 1049832829 8:144713241-144713263 CCCGGGGTCACCGGCCGCAGTGC No data
Right 1049832837 8:144713266-144713288 CTTTCGGCTCCAGGGAAGCGCGG No data
1049832829_1049832839 25 Left 1049832829 8:144713241-144713263 CCCGGGGTCACCGGCCGCAGTGC No data
Right 1049832839 8:144713289-144713311 ACTCGCCCCTGCTGCCCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049832829 Original CRISPR GCACTGCGGCCGGTGACCCC GGG (reversed) Intergenic
No off target data available for this crispr