ID: 1049832831

View in Genome Browser
Species Human (GRCh38)
Location 8:144713250-144713272
Sequence ACCGGCCGCAGTGCTCCTTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049832826_1049832831 0 Left 1049832826 8:144713227-144713249 CCAACAGGTTTCCGCCCGGGGTC No data
Right 1049832831 8:144713250-144713272 ACCGGCCGCAGTGCTCCTTTCGG No data
1049832821_1049832831 11 Left 1049832821 8:144713216-144713238 CCGGTGCGCTCCCAACAGGTTTC No data
Right 1049832831 8:144713250-144713272 ACCGGCCGCAGTGCTCCTTTCGG No data
1049832818_1049832831 30 Left 1049832818 8:144713197-144713219 CCTCTGTGGACGGCTACTTCCGG No data
Right 1049832831 8:144713250-144713272 ACCGGCCGCAGTGCTCCTTTCGG No data
1049832825_1049832831 1 Left 1049832825 8:144713226-144713248 CCCAACAGGTTTCCGCCCGGGGT No data
Right 1049832831 8:144713250-144713272 ACCGGCCGCAGTGCTCCTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049832831 Original CRISPR ACCGGCCGCAGTGCTCCTTT CGG Intergenic